942 resultados para GENOMIC DNA METHYLATION


Relevância:

90.00% 90.00%

Publicador:

Resumo:

PURPOSE: O6-methylguanine-methyltransferase (MGMT) promoter methylation has been shown to predict survival of patients with glioblastomas if temozolomide is added to radiotherapy (RT). It is unknown if MGMT promoter methylation is also predictive to outcome to RT followed by adjuvant procarbazine, lomustine, and vincristine (PCV) chemotherapy in patients with anaplastic oligodendroglial tumors (AOT). PATIENTS AND METHODS: In the European Organisation for the Research and Treatment of Cancer study 26951, 368 patients with AOT were randomly assigned to either RT alone or to RT followed by adjuvant PCV. From 165 patients of this study, formalin-fixed, paraffin-embedded tumor tissue was available for MGMT promoter methylation analysis. This was investigated with methylation specific multiplex ligation-dependent probe amplification. RESULTS: In 152 cases, an MGMT result was obtained, in 121 (80%) cases MGMT promoter methylation was observed. Methylation strongly correlated with combined loss of chromosome 1p and 19q loss (P = .00043). In multivariate analysis, MGMT promoter methylation, 1p/19q codeletion, tumor necrosis, and extent of resection were independent prognostic factors. The prognostic significance of MGMT promoter methylation was equally strong in the RT arm and the RT/PCV arm for both progression-free survival and overall survival. In tumors diagnosed at central pathology review as glioblastoma, no prognostic effect of MGMT promoter methylation was observed. CONCLUSION: In this study, on patients with AOT MGMT promoter methylation was of prognostic significance and did not have predictive significance for outcome to adjuvant PCV chemotherapy. The biologic effect of MGMT promoter methylation or pathogenetic features associated with MGMT promoter methylation may be different for AOT compared with glioblastoma.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Ants have evolved very complex societies and are key ecosystem members. Some ants, such as the fire ant Solenopsis invicta, are also major pests. Here, we present a draft genome of S. invicta, assembled from Roche 454 and Illumina sequencing reads obtained from a focal haploid male and his brothers. We used comparative genomic methods to obtain insight into the unique features of the S. invicta genome. For example, we found that this genome harbors four adjacent copies of vitellogenin. A phylogenetic analysis revealed that an ancestral vitellogenin gene first underwent a duplication that was followed by possibly independent duplications of each of the daughter vitellogenins. The vitellogenin genes have undergone subfunctionalization with queen- and worker-specific expression, possibly reflecting differential selection acting on the queen and worker castes. Additionally, we identified more than 400 putative olfactory receptors of which at least 297 are intact. This represents the largest repertoire reported so far in insects. S. invicta also harbors an expansion of a specific family of lipid-processing genes, two putative orthologs to the transformer/feminizer sex differentiation gene, a functional DNA methylation system, and a single putative telomerase ortholog. EST data indicate that this S. invicta telomerase ortholog has at least four spliceforms that differ in their use of two sets of mutually exclusive exons. Some of these and other unique aspects of the fire ant genome are likely linked to the complex social behavior of this species.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT) antagonizes the genotoxic effects of alkylating agents. MGMT promoter methylation is the key mechanism of MGMT gene silencing and predicts a favorable outcome in patients with glioblastoma who are exposed to alkylating agent chemotherapy. This biomarker is on the verge of entering clinical decision-making and is currently used to stratify or even select glioblastoma patients for clinical trials. In other subtypes of glioma, such as anaplastic gliomas, the relevance of MGMT promoter methylation might extend beyond the prediction of chemosensitivity, and could reflect a distinct molecular profile. Here, we review the most commonly used assays for evaluation of MGMT status, outline the prerequisites for standardized tests, and evaluate reasons for difficulties in reproducibility. We critically discuss the prognostic and predictive value of MGMT silencing, reviewing trials in which patients with different types of glioma were treated with various chemotherapy schedules, either up-front or at recurrence. Standardization of MGMT testing requires comparison of different technologies across laboratories and prospectively validated cut-off values for prognostic or predictive effects. Moreover, future clinical trials will need to determine, for each subtype of glioma, the degree to which MGMT promoter methylation is predictive or prognostic, and whether testing should become routine clinical practice.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The O6-methylguanine-DNA-methyltransferase (MGMT) promoter methylation status is a predictive parameter for the response of malignant gliomas to alkylating agents such as temozolomide. First clinical trials with temozolomide plus bevacizumab therapy in metastatic melanoma patients are ongoing, although the predictive value of the MGMT promoter methylation status in this setting remains unclear. We assessed MGMT promoter methylation in formalin-fixed, primary tumor tissue of metastatic melanoma patients treated with first-line temozolomide and bevacizumab from the trial SAKK 50/07 by methylation-specific polymerase chain reaction. In addition, the MGMT expression levels were also analyzed by MGMT immunohistochemistry. Eleven of 42 primary melanomas (26%) revealed a methylated MGMT promoter. Promoter methylation was significantly associated with response rates CR + PR versus SD + PD according to RECIST (response evaluation criteria in solid tumors) (p<0.05) with a trend to prolonged median progression-free survival (8.1 versus 3.4 months, p>0.05). Immunohistochemically different protein expression patterns with heterogeneous and homogeneous nuclear MGMT expression were identified. Negative MGMT expression levels were associated with overall disease stabilization CR+PR+SD versus PD (p=0.05). There was only a poor correlation between MGMT methylation and lack of MGMT expression. A significant proportion of melanomas have a methylated MGMT promoter. The MGMT promoter methylation status may be a promising predictive marker for temozolomide therapy in metastatic melanoma patients. Larger sample sizes may help to validate significant differences in survival type endpoints.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Resistance to alkylating agents via direct DNA repair by O(6)-methylguanine methyltransferase (MGMT) remains a significant barrier to the successful treatment of patients with malignant glioma. The relative expression of MGMT in the tumor may determine response to alkylating agents, and epigenetic silencing of the MGMT gene by promoter methylation plays an important role in regulating MGMT expression in gliomas. MGMT promoter methylation is correlated with improved progression-free and overall survival in patients treated with alkylating agents. Strategies to overcome MGMT-mediated chemoresistance are being actively investigated. These include treatment with nontoxic pseudosubstrate inhibitors of MGMT, such as O(6)-benzylguanine, or RNA interference-mediated gene silencing of MGMT. However, systemic application of MGMT inhibitors is limited by an increase in hematologic toxicity. Another strategy is to deplete MGMT activity in tumor tissue using a dose-dense temozolomide schedule. These alternative schedules are well tolerated; however, it remains unclear whether they are more effective than the standard dosing regimen or whether they effectively deplete MGMT activity in tumor tissue. Of note, not all patients with glioblastoma having MGMT promoter methylation respond to alkylating agents, and even those who respond will inevitably experience relapse. Herein we review the data supporting MGMT as a major mechanism of chemotherapy resistance in malignant gliomas and describe ongoing studies that are testing resistance-modulating strategies.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

PURPOSE: To report the first case of choroidal schwannoma in a patient affected by PTEN hamartoma tumor syndrome (PHTS) and investigate the molecular involvement of the phosphatase and tensin homolog (PTEN) and neurofibromin 2 (NF2) genes in this rare intraocular tumor. DESIGN: Observational case report. PARTICIPANT: A 10-year-old girl diagnosed with PHTS. METHODS: The enucleated specimen underwent histologic, immunohistochemical, and transmission electronic microscopy. The expression of PTEN and NF2 and their protein products were evaluated by reverse transcription-polymerase chain reaction and immunohistochemistry. Somatic mutations of PTEN and NF2, as well as allelic loss, were investigated by direct sequencing of DNA extracted from the tumor. PTEN epigenetic silencing was investigated by pyrosequencing. MAIN OUTCOME MEASURES: Histopathologic and molecular characterization of a choroidal pigmented schwannoma. RESULTS: Histopathologic, immunohistochemical, and electron microscopic analysis demonstrated features consistent with a pigmented cellular schwannoma of the choroid. We found no loss of heterozygosity at the genomic level for the PTEN germline mutation and no promoter hypermethylation or other somatic intragenic mutations. However, we observed an approximate 40% reduction of PTEN expression at both the mRNA and the protein level, indicating that the tumor was nonetheless functionally deficient for PTEN. Although DNA sequencing of NF2 failed to identify any pathologic variants, its expression was abolished within the tumor. CONCLUSIONS: We report the first description of a pigmented choroidal schwannoma in the context of a PHTS. This rare tumor showed a unique combination of reduction of PTEN and absence of NF2 expression.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

BACKGROUND: Silver-Russell syndrome (SRS) is a genetically and clinically heterogeneous disease. Although no protein coding gene defects have been reported in SRS patients, approximately 50% of SRS patients carry epimutations (hypomethylation) at the IGF2/H19 imprinting control region 1 (ICR1). Proper methylation at ICR1 is crucial for the imprinted expression of IGF2, a fetal growth factor. CTCFL, a testis-specific protein, has recently been proposed to play a role in the establishment of DNA methylation at the murine equivalent of ICR1. A screen was undertaken to assess whether CTCFL is mutated in SRS patients with hypomethylation, to explore a link between the observed epimutations and a genetic cause of the disease. METHODOLOGY/PRINCIPAL FINDINGS: DNA was obtained from 36 SRS patients with hypomethylation at ICR1. All CTCFL coding exons were sequenced and analyzed for duplications/deletions using both multiplex ligation-dependent probe amplification, with a custom CTCFL probe set, and genomic qPCR. Novel SNP alleles were analyzed for potential differential splicing in vitro utilizing a splicing assay. Neither mutations of CTCFL nor duplications/deletions were observed. Five novel SNPs were identified and have been submitted to dbSNP. In silico splice prediction suggested one novel SNP, IVS2-66A>C, activated a cryptic splice site, resulting in aberrant splicing and premature termination. In vitro splicing assays did not confirm predicted aberrant splicing. CONCLUSIONS/SIGNIFICANCE: As no mutations were detected at CTCFL in the patients examined, we conclude that genetic alterations of CTCFL are not responsible for the SRS hypomethylation. We suggest that analysis of other genes involved in the establishment of DNA methylation at imprinted genes, such as DNMT3A and DNMT3L, may provide insight into the genetic cause of hypomethylation in SRS patients.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Medulloblastomas (MB) are the most common malignant brain tumors in childhood. Alkylator-based drugs are effective agents in the treatment of patients with MB. In several tumors, including malignant glioma, elevated O(6)-methylguanine-DNA methyltransferase (MGMT) expression levels or lack of MGMT promoter methylation have been found to be associated with resistance to alkylating chemotherapeutic agents such as temozolomide (TMZ). In this study, we examined the MGMT status of MB and central nervous system primitive neuroectodermal tumor (PNET) cells and two large sets of primary MB. In seven MB/PNET cell lines investigated, MGMT promoter methylation was detected only in D425 human MB cells as assayed by the qualitative methylation-specific PCR and the more quantitative pyrosequencing assay. In D425 human MB cells, MGMT mRNA and protein expression was clearly lower when compared with the MGMT expression in the other MB/PNET cell lines. In MB/PNET cells, sensitivity towards TMZ and 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea (CCNU) correlated with MGMT methylation and MGMT mRNA expression. Pyrosequencing in 67 primary MB samples revealed a mean percentage of MGMT methylation of 3.7-92% (mean: 13.25%, median: 10.67%). Percentage of MGMT methylation and MGMT mRNA expression as determined by quantitative RT-PCR correlated inversely (n = 46; Pearson correlation r (2) = 0.14, P = 0.01). We then analyzed MGMT mRNA expression in a second set of 47 formalin-fixed paraffin-embedded primary MB samples from clinically well-documented patients treated within the prospective randomized multicenter trial HIT'91. No association was found between MGMT mRNA expression and progression-free or overall survival. Therefore, it is not currently recommended to use MGMT mRNA expression analysis to determine who should receive alkylating agents and who should not.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

BACKGROUND: The P-type II ATPase gene family encodes proteins with an important role in adaptation of the cell to variation in external K+, Ca2+ and Na2+ concentrations. The presence of P-type II gene subfamilies that are specific for certain kingdoms has been reported but was sometimes contradicted by discovery of previously unknown homologous sequences in newly sequenced genomes. Members of this gene family have been sampled in all of the fungal phyla except the arbuscular mycorrhizal fungi (AMF; phylum Glomeromycota), which are known to play a key-role in terrestrial ecosystems and to be genetically highly variable within populations. Here we used highly degenerate primers on AMF genomic DNA to increase the sampling of fungal P-Type II ATPases and to test previous predictions about their evolution. In parallel, homologous sequences of the P-type II ATPases have been used to determine the nature and amount of polymorphism that is present at these loci among isolates of Glomus intraradices harvested from the same field. RESULTS: In this study, four P-type II ATPase sub-families have been isolated from three AMF species. We show that, contrary to previous predictions, P-type IIC ATPases are present in all basal fungal taxa. Additionally, P-Type IIE ATPases should no longer be considered as exclusive to the Ascomycota and the Basidiomycota, since we also demonstrate their presence in the Zygomycota. Finally, a comparison of homologous sequences encoding P-type IID ATPases showed unexpectedly that indel mutations among coding regions, as well as specific gene duplications occur among AMF individuals within the same field. CONCLUSION: On the basis of these results we suggest that the diversification of P-Type IIC and E ATPases followed the diversification of the extant fungal phyla with independent events of gene gains and losses. Consistent with recent findings on the human genome, but at a much smaller geographic scale, we provided evidence that structural genomic changes, such as exonic indel mutations and gene duplications are less rare than previously thought and that these also occur within fungal populations.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The CD44 adhesion receptor is silenced in highly malignant neuroblastomas (NBs) with MYCN amplification. Because its functional expression is associated with decreased tumorigenic properties, CD44 behaves as a tumor suppressor gene in NB and other cancers. Given that the precise mechanisms responsible for CD44 silencing are not elucidated, we investigated whether CD44 expression could be regulated by DNA hypermethylation. The methylation status of CD44 gene promoter and exon 1 regions was analyzed in 12 NB cell lines and 21 clinical samples after bisulfite genomic modification, followed by PCR and single-strand conformation polymorphism analysis and genomic sequencing. The results showed that almost all CD44-negative cell lines displayed hypermethylation in both regions, whereas all CD44-expressing cell lines were unmethylated. These observations correlated with the ability to restore CD44 mRNA and protein expression by treatment of CD44-negative cells with the 5-aza-2'-deoxycytidine demethylating agent. In contrast, no CD44 gene hypermethylation could be detected in 21 NB clinical samples of different stages, irrespective of CD44 expression. Although our results suggest that aberrant methylation of promoter and exon 1 regions is involved in CD44 silencing in NB cell lines, they also indicate that methylation of unidentified regulatory sequences or methylation-independent mechanisms also control the expression of CD44 in primary NB tumors and cell lines. We therefore conclude that CD44 silencing is controlled by complex and tumor cell-specific processes, including gene hypermethylation. Further investigation of other mechanisms and genes involved in CD44 regulation will be needed before demethylation-mediated reactivation of the CD44 gene can be considered as therapeutic strategy for neuroblastoma and perhaps other related cancers.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The Caulobacter DNA methyltransferase CcrM is one of five master cell-cycle regulators. CcrM is transiently present near the end of DNA replication when it rapidly methylates the adenine in hemimethylated GANTC sequences. The timing of transcription of two master regulator genes and two cell division genes is controlled by the methylation state of GANTC sites in their promoters. To explore the global extent of this regulatory mechanism, we determined the methylation state of the entire chromosome at every base pair at five time points in the cell cycle using single-molecule, real-time sequencing. The methylation state of 4,515 GANTC sites, preferentially positioned in intergenic regions, changed progressively from full to hemimethylation as the replication forks advanced. However, 27 GANTC sites remained unmethylated throughout the cell cycle, suggesting that these protected sites could participate in epigenetic regulatory functions. An analysis of the time of activation of every cell-cycle regulatory transcription start site, coupled to both the position of a GANTC site in their promoter regions and the time in the cell cycle when the GANTC site transitions from full to hemimethylation, allowed the identification of 59 genes as candidates for epigenetic regulation. In addition, we identified two previously unidentified N(6)-methyladenine motifs and showed that they maintained a constant methylation state throughout the cell cycle. The cognate methyltransferase was identified for one of these motifs as well as for one of two 5-methylcytosine motifs.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

While genetic mutation is a hallmark of cancer, many cancers also acquire epigenetic alterations during tumorigenesis including aberrant DNA hypermethylation of tumor suppressors, as well as changes in chromatin modifications as caused by genetic mutations of the chromatin-modifying machinery. However, the extent of epigenetic alterations in cancer cells has not been fully characterized. Here, we describe complete methylome maps at single nucleotide resolution of a low-passage breast cancer cell line and primary human mammary epithelial cells. We find widespread DNA hypomethylation in the cancer cell, primarily at partially methylated domains (PMDs) in normal breast cells. Unexpectedly, genes within these regions are largely silenced in cancer cells. The loss of DNA methylation in these regions is accompanied by formation of repressive chromatin, with a significant fraction displaying allelic DNA methylation where one allele is DNA methylated while the other allele is occupied by histone modifications H3K9me3 or H3K27me3. Our results show a mutually exclusive relationship between DNA methylation and H3K9me3 or H3K27me3. These results suggest that global DNA hypomethylation in breast cancer is tightly linked to the formation of repressive chromatin domains and gene silencing, thus identifying a potential epigenetic pathway for gene regulation in cancer cells.