952 resultados para Dna-sequence


Relevância:

60.00% 60.00%

Publicador:

Resumo:

An unusual new species of the gall-inducing scale insect genus Apiomorpha Rubsaamen is described from Queensland. The adult female, its gall, and the first-instar nymph (crawler) are illustrated, and relationships of the new species are estimated using mitochondrial COII data. Adult females induce cigar-shaped galls on leaves of several eucalypts in section Adnataria of subgenus Symphyomyrtus. The bilobed anal lobes of the adult female differ from those of all other Apiomorpha species (single lobe) and the first-instar nymph possesses features, such as broad frontal tubercles and dorsal stripes, that are not present in crawlers of other Apiomorpha species. However, DNA sequence data confirm that the new species falls within Apiomorpha, rather than representing a sister group, and indicate that the new species is not closely related to the A. pharetrata (Schrader) species-group, the only other group within Apiomorpha that induces cigar-shaped galls on leaves. The systematic affiliations of A. gullanae sp. n. are currently not known. Females only are known and there is some indication that reproduction in the new taxon is parthenogenetic. This represents the first putative case of parthenogenesis in Apiomorpha.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The habit of inducing plant galls has evolved multiple times among insects but most species diversity occurs in only a few groups, such as gall midges and gall wasps. This phylogenetic clustering may reflect adaptive radiations in insect groups in which the trait has evolved. Alternatively, multiple independent origins of galling may suggest a selective advantage to the habit. We use DNA sequence data to examine the origins of galling among the most speciose group of gall-inducing scale insects, the eriococcids. We determine that the galling habit has evolved multiple times, including four times in Australian taxa, suggesting that there has been a selective advantage to galling in Australia. Additionally, although most gall-inducing eriococcid species occur on Myrtaceae, we found that lineages feeding on Myrtaceae are no more likely to have evolved the galling habit than those feeding on other plant groups. However, most gall-inducing species-richness is clustered in only two clades (Apiomorpha and Lachnodius + Opisthoscelis), all of which occur exclusively on Eucalyptus s.s. The Eriococcidae and the large genus Eriococcus were determined to be non-monophyletic and each will require revision. (C) 2004 The Linnean Society of London.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

An analysis of the relationships of the major arthropod groups Was undertaken using mitochondrial genome data to examine the hypotheses that Hexapoda is polyphyletic and that Collembola is more closely related to branchiopod crustaceans than insects. We sought to examine the sensitivity of this relationship to outgroup choice, data treatment. gene choice and optimality criteria used in the phylogenetic analysis of mitochondrial genome data. Additionally we sequenced the mitochondrial genome of ail archaeognathan, Nesomachilis australica. to improve taxon selection in the apterygote insects, a group poorly represented in previous mitochondrial phylogenies. The sister group of the Collembola was rarely resolved in our analyses with a significant level of support. The use of different outgroups (myriapods, nematodes, or annelids + mollusks) resulted in many different placements of Collembola. The way in which the dataset was coded for analysis (DNA, DNA with the exclusion of third codon position and as amino acids) also had marked affects on tree topology. We found that nodal Support was spread evenly throughout the 13 mitochondrial genes and the exclusion of genes resulted in significantly less resolution in the inferred trees. Optimality criteria had a much lesser effect on topology than the preceding factors; parsimony and Bayesian trees for a given data set and treatment were quite similar. We therefore conclude that the relationships of the extant arthropod groups as inferred by mitochondrial genomes are highly vulnerable to outgroup choice, data treatment and gene choice, and no consistent alternative hypothesis of Collembola's relationships is supported. Pending the resolution of these identified problems with the application of mitogenomic data to basal arthropod relationships, it is difficult to justify the rejection of hexapod monophyly, which is well supported on morphological grounds. (c) The Willi Hennig Society 2004.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Phylogenetic trees can provide a stable basis for a higher-level classification of organisms that reflects evolutionary relationships. However, some lineages have a complex evolutionary history that involves explosive radiation or hybridisation. Such histories have become increasingly apparent with the use of DNA sequence data for phylogeny estimation and explain, in part, past difficulties in producing stable morphology-based classifications for some groups. We illustrate this situation by using the example of tribe Mirbelieae (Fabaceae), whose generic classification has been fraught for decades. In particular, we discuss a recent proposal to combine 19 of the 25 Mirbelieae genera into a single genus, Pultenaea sens. lat., and how we might find stable and consistent ways to squeeze something as complex as life into little boxes for our own convenience. © CSIRO.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Amongst the infectious diseases that threaten equine health, herpesviral infections remain a world wide cause of serious morbidity and mortality. Equine herpesvirus-1 infection is the most important pathogen, causing an array of disorders including epidemic respiratory disease abortion, neonatal foal death, myeloencephalopathy and chorioretinopathy. Despite intense scientific investigation, extensive use of vaccination, and established codes of practice for control of disease outbreaks, infection and disease remain common. While equine herpesvirus-1 infection remains a daunting challenge for immunoprophylaxis, many critical advances in equine immunology have resulted in studies of this virus, particularly related to MHC-restricted cytotoxicity in the horse. A workshop was convened in San Gimignano, Tuscany, Italy in June 2004, to bring together clinical and basic researchers in the field of equine herpesvirus-1 study to discuss the latest advances and future prospects for improving our under-standing of these diseases, and equine immunity to herpesviral infection. This report highlights the new information that was the focus of this workshop, and is intended to summarize this material and identify the critical questions in the field. (c) 2006 Elsevier B.V. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Background/Aims: Approximately four million Africans were taken as slaves to Brazil, where they interbred extensively with Amerindians and Europeans. We have previously shown that while most White Brazilians carry Y chromosomes of European origin, they display high proportions of African and Amerindian mtDNA lineages, because of sex-biased genetic admixture. Methods: We studied the Y chromosome and mtDNA haplogroup structure of 120 Black males from Sao Paulo, Brazil. Results: Only 48% of the Y chromosomes, but 85% of the mtDNA haplogroups were characteristic of sub-Saharan Africa, confirming our previous observation of sexually biased mating. We mined literature data for mtDNA and Y chromosome haplogroup frequencies for African native populations from regions involved in Atlantic Slave Trade. Principal Components Analysis and Bayesian analysis of population structure revealed no genetic differentiation of Y chromosome marker frequencies between the African regions. However, mtDNA examination unraveled considerable genetic structure, with three clusters at Central-West Africa, West Africa and Southeast Africa. A hypothesis is proposed to explain this structure. Conclusion: Using these mtDNA data we could obtain for the first time an estimate of the relative ancestral contribution of Central-West (0.445), West (0.431) and Southeast Africa (0.123) to African Brazilians from Sao Paulo. These estimates are consistent with historical information. Copyright (c) 2008 S. Karger AG, Basel.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

We showed in 1988 that there are two strains of Chlamydia psittaci which infect the koala (Phascolarctos cinereus). In order to further investigate the role of these chlamydial strains in pathogenesis, we have attempted to identify genes of koala type I strain chlamydial which are involved in the immunogenic response, Transformation of Escherichia coli with a plasmid containing a 6.3-kb fragment (pKOC-10) of C. psittaci DNA caused the appearance of a specific chlamydial lipopolysaccharide (LPS) epitope on the host strain. The smallest DNA fragment capable of inducing the expression of chlamydial LPS was an Xbal fragment, 2.4 kb in size (pKOC-5). DNA sequence analysis of the complete fragment revealed regions of high identity, at the amino acid level, to the gseA genes of C. pneomoniae, C. psittaci 6BC and C. trachomatis, and the kdtA gene of E. coli which code for transferases catalysing the addition of 3-deoxy-D-manno-octulosonic acid (Kdo) residues to lipid A. Two open reading frames (ORFs) of 1,314 and 501 nucleotides in size, within the 2.4-kb fragment, were evident, and mRNA species corresponding to these ORFs were detected by Northern analysis. Both ORF1 and ORF2 are required for the appearance of chlamydia-specific LPS on the surface of recombinant E. coli.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Helicobacter pylori infection is very prevalent in Brazil, infecting almost 65% of the population. The aim of this study was to evaluate the presence of this bacterium in the oral cavity of patients with functional dyspepsia (epigastric pain syndrome), establish the main sites of infection in the mouth, and assess the frequency of cagA and vacA genotypes of oral H. pylori. All 43 outpatients with epigastric pain syndrome, who entered the study, were submitted to upper gastrointestinal endoscopy to rule out organic diseases. Helicobacter pylori infection in the stomach was confirmed by a rapid urease test and urea breath tests. Samples of saliva, the tongue dorsum and supragingival dental plaque were collected from the oral cavity of each subject and subgingival dental plaque samples were collected from the patients with periodontitis; H. pylori infection was verified by polymerase chain reaction using primers that amplify the DNA sequence of a species-specific antigen present in all H. pylori strains; primers that amplify a region of urease gene, and primers for cagA and vacA (m1, m2, s1a, s1b, s2) genotyping. Thirty patients harbored H. pylori in the stomach, but it was not possible to detect H. pylori in any oral samples using P1/P2 and Urease A/B. The genotype cagA was also negative in all samples and vacA genotype could not be characterized (s-m-). The oral cavity may not be a reservoir for H. pylori in patients with epigastric pain syndrome, the bacterium being detected exclusively in the stomach.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Background: Using enzyme immunoassays and Western blot (Wb) tests, HTLV serodiagnosis yields indeterminate results in a significant number of cases. Objective: To determine the prevalence of HTLV infection among HTLV-seroindeterminate individuals. Study design: We studied peripheral blood mononuclear cells from 65 anti-HTLV Wb-seroindeterminate individuals by attempting to amplify proviral DNA sequences (tax and pot) to identify HTLV-I and HTLV-2 infections. Results: These 65 specimens exhibited predominantly (43%) anti-HTLV antibodies to gag-coded antigens in the absence of anti-p24 on Wb analysis. Tax proviral sequences were detected in 6 (9.2%) samples. According to restricted fragment polymorphism analysis (RFLP), we identified HTLV-1 proviral DNA in 4 samples. HTLV-2 in one and sequences from both in another. Nested PCR for the pot region was positive in 3 (4.6%) specimens, which were also positive for tax sequences. After hybridization HTLV-1 infection was confirmed in 2 samples (3.1%) and HTLV-2 in another (1.5%). Detection of a single HTLV DNA sequence may be due to infection by defective provirus, but its significance remains undefined. In this cohort, no Wb reactivity pattern was predictive of proviral detection. HTLV-I infection was demonstrated in an individual who had Wb reactivity to gag-coded antigens only. Conclusions: This emphasizes the importance of clinical and laboratory follow-up of HTLV-seroindeterminate individuals from endemic areas. (c) 2009 Elsevier B.V. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Objective: Prostate cancer (PCa) is the most frequent tumor in males in Brazil. Single nucleotide polymorphisms (SNP) have been demonstrated in the promoter region of matrix metalloproteinases (MMPs) genes and have been associated with development and progression of some cancers. In this study, our aim was to investigate a possible relation between polymorphism of the promoter region of the MMP2 gene and classical prognostic parameters in prostate cancer. Materials and methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by real-time polymerase chain reaction, using fluorescent probes (TaqMan). Results: In patients with tumors of a higher stage (pT3), a polymorphic allele in the MMP2 gene was more frequent (P = 0.026) than in patients with lower tumor stage. A polymorphic allele in the MMP2 gene was more frequent in Gleason >= 7 than in Gleason <= 6 (P = 0.042). Conclusions: We conclude that MMP2 polymorphism can be used together with pathological stage and Gleason score to identify patients with worse prognosis. Our results illustrate the potential use of MMP2 SNP as a molecular marker for prostate cancer. (C) 2010 Elsevier Inc. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Purpose: Prostate cancer is the most common tumor in males in Brazil. Single nucleotide polymorphisms have been demonstrated to exist in the promoter regions of matrix metalloproteinase genes and they are associated with the development and progression of some cancers. We investigated the correlation between MMP1, 2, 7 and 9 polymorphisms with susceptibility to prostate cancer, and classic prognostic parameters of prostate cancer. Materials and Methods: Genomic DNA was extracted using conventional protocols. The DNA sequence containing the polymorphic site was amplified by realtime polymerase chain reaction using TaqMan (R) fluorescent probes. Results: For the MMP1 gene the polymorphic allele was more common in the control group than in the prostate cancer group (p <0.001). For the MMP9 gene the incidence of the polymorphic homozygote genotype was higher in the prostate cancer group (p <0.001). For higher stage tumors (pT3) a polymorphic allele in the MMP2 gene was more common (p = 0.026). When considering Gleason score, the polymorphic homozygote genotype of MMP9 was more common in Gleason 6 or less tumors (p = 0.003), while a polymorphic allele in the MMP2 gene was more common in Gleason 7 or greater tumors (p = 0.042). Conclusions: MMP1 and MMP2 may protect against prostate cancer development and MMP9 may be related to higher risk. In contrast, MMP9 polymorphism was associated with a lower Gleason score and MMP2 polymorphism was associated with nonorgan confined disease.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Objective: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G > C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic variables. Methods: The ECP genotypes of 165 healthy individuals and 157 OSCC patients were detected by PCR-RFLP analysis after cleavage of the amplified DNA sequence with enzyme PstI. TATE was obtained by morphometric analysis. Chi-square test or Fisher`s exact test was used to analyze the association of ECP-gene polymorphism 434(G > C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test. Results: Most of healthy individuals (53.33%) and OSCC patients (57.97%) were heterozygous for the ECP 434(G > C) polymorphism. Based on numerical differences, our results showed that OSCC patients with intense TATE and at least one C allele had a higher frequency of bilateral neck dissection, local recurrence, vascular embolization, involved resection margins, and postoperative radiotherapy. No statistically significant differences on survival rates were found in OSCC patients presenting different ECP 434(G > C) genotypes. Conclusions: These results suggest a tendency towards a poor clinical outcome in OSCC patients with intense TATE and 434GC/CC genotypes, probably due to an ECP genetic variant with altered cytotoxic activity.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The complete arrangement of genes in the mitochondrial (mt) genome is known for 12 species of insects, and part of the gene arrangement in the mt genome is known for over 300 other species of insects. The arrangement of genes in the mt genome is very conserved in insects studied, since all of the protein-coding and rRNA genes and most of the tRNA genes are arranged in the same way. We sequenced the entire mt genome of the wallaby louse, Heterodoxus macropus, which is 14,670 bp long and has the 37 genes typical of animals and some noncoding regions. The largest noncoding region is 73 bp long (93% A+T), and the second largest is 47 bp long (92% AST). Both of these noncoding regions seem to be able to form stem-loop structures. The arrangement of genes in the mt genome of this louse is unlike that of any other animal studied. All tRNA genes have moved and/or inverted relative to the ancestral gene arrangement of insects, which is present in the fruit fly Drosophila yakuba. At least nine protein-coding genes (atp6, atp8, cox2, cob, nad1-nad3, nad5, and nad6) have moved; moreover, four of these genes (atp6, atp8, nad1, and nad3) have inverted. The large number of gene rearrangements in the mt genome of H. macropus is unprecedented for an arthropod.