996 resultados para DNA-DNA HYBRIDIZATION
Resumo:
Projecte de recerca elaborat a partir d’una estada al Department for Feed and Food Hygiene del National Veterinary Institute, Noruega, entre novembre i desembre del 2006. Els grans de cereal poden estar contaminats amb diferents espècies de Fusarium capaces de produir metabolits secundaris altament tòxics com trichotecenes, fumonisines o moniliformines. La correcta identificació d’aquestes espècies és de gran importància per l’assegurament del risc en l’àmbit de la salut humana i animal. La identificació de Fusarium en base a la seva morfologia requereix coneixements taxonòmics i temps; la majoria dels mètodes moleculars permeten la identificació d’una única espècie diana. Per contra, la tecnologia de microarray ofereix l’anàlisi paral•lel d’un alt nombre de DNA dianes. En aquest treball, s’ha desenvolupat un array per a la identificació de les principals espècies de Fusarium toxigèniques del Nord i Sud d’Europa. S’ha ampliat un array ja existent, per a la detecció de les espècies de Fusarium productores de trichothecene i moniliformina (predominants al Nord d’Europa), amb l’addició de 18 sondes de DNA que permeten identificar les espècies toxigèniques més abundants al Sud d’Europa, les qual produeixen majoritàriament fumonisines. Les sondes de captura han estat dissenyades en base al factor d’elongació translació- 1 alpha (TEF-1alpha). L’anàlisi de les mostres es realitza mitjançant una única PCR que permet amplificar part del TEF-1alpha seguida de la hibridació al xip de Fusarium. Els resultats es visualitzen mitjançant un mètode de detecció colorimètric. El xip de Fusarium desenvolupat pot esdevenir una eina útil i de gran interès per a l’anàlisi de cereals presents en la cadena alimentària.
Resumo:
The development of a repetitive DNA probe for Babesia bigemina was reviewed. The original plasmid (p(Bbi)16) contained an insert of B. bigemina DNA of approximately 6.3 kb. This probe has been evaluated for specificityand analytical sensitivity by dot hybridization with isolates from Mexico, the Caribbean region and Kenya. A partial restriction map has been constructed and insert fragments have been subcloned and utilized as specific DNA probes. A comparison of 32P labelled and non-radioactive DNA probes was presented. Non-radioctive detection systems that have been used include digoxigenin dUTP incorporation, and detection by colorimetric substrate methods. Derivatives from the original DNA probe have been utilized to detect B. bigemina infection in a) experimentally inoculated cattle, b) field exposed cattle, c) infected Boophilus microplus ticks, and d) the development of a PCR amplification system.
Resumo:
An epidemiological survey was conducted in south east Mexico, in an effort to establish the serological reactivity and carrier status to Babesia bigemina of an indigenous cattle population. The prevalance was obtained through the Indirect Fluorescent Antibody Test (IFAT), using an in vitro culture-derived B. bigemina antigen. A specific, digoxigenin-coupled, ~6kb B. bigemina-DNA probe (BBDP), was used to indicate the presence of the parasite. Serum samples from 925 animals of all ages, were obtained within the three regions (I, II, III) of the state of Yucatan and tested by IFAT. In addition, whole blood samples draw from 136 of the same animals of region II were analyzed using the BBDP. Positive IFAT (IFAT+) reactions were observed in 531 sera for a 57% overall prevalence. Regional values were: I = 157 + (56%), II = 266 + (68%) and III = 108 + (42%). Only 32 (23%) of the blood samples tested with BBDP showed distinctive hybridization signal, in contrast with 100 (73%) IFAT + animals. The responses distribution for IFAT vs. BBDP was: +/+ 23, +/- 77, -/+ 9 and -/- 27 respectively. It was found that the analytical sinsitivity of BBDP appears to be low for its utilization is widespread epidemiological surveys. It was considered, however, that the colorimetric probe mifht to be useful to safely detect transmission prone carriers, since it is able to detect parasitemias as low as 0.001%.
Resumo:
Cercarial shedding tests do not provide species identification of the shistosomes concerned and cannot detect prepatent schistosomal infections. We have demonstrated that both immunodetection by ELISA of schistosomal antigens in snail hemophlymph, and dot hybridization of snail extracts by DNA probe representing highly repeated sequences, proved suitable for detecting infected snails during prepatnecy as well as patency. A group-specific monoclonal antibody was found to be suitable for detecting Schistosoma mansoni infection in Biomphalaria sp., but not for positive identification of S. haematobium in Blulinus sp. Comparative evaluation of the diagnostic qualities, and technical aspects and cost of these tests, point to the superiority of the immunodetection approach for large scale detection of snails prepatently infected with S. mansoni. This approach is potentially useful for providing extended information on schistosome-snail epidemiology that may facilitate rapid evaluation of the danger of post-control reinfection, and help make decisions on the time and place of supplementary control measures. In this context the potential usefulness of the immunodetection or DNA probing approach for facilitating catalytic model representation of schistosome-snail epidemiology warrants further evaluation. Specific identification of S. haematobium in Bulinus by either of these approaches may be possible depending on the development of suitable antibodies or DNA probes.
Resumo:
A hundred-sixty paraffin-embedded specimens from female cervical lesions were examined for human papillomavirus (HPV) types 6, 11, 16 and 18 infections by non-isotopic in situ hybridization. The data were compared with histologic diagnosis. Eighty-eight (55) biopsies contained HPV DNA sequences. In low grade cervical intraepithelial neoplasias (CIN I), HPV infection was detected in 78.7 of the cases, the benign HPV 6 was the most prevalent type. HPV DNA was detected in 58 of CIN II and CIN III cases and in 41.8 of squamous cell carcinomas (SCC). Histologically normal women presented 20 of HPV infection. Oncogenic HPV was found in 10 of these cases, what may indicate a higher risk of developing CINs and cancer. Twenty-five percent of the infected tissues contained mixed infections. HPV 16 was the most common type infecting the cervix and its prevalence raised significantly with the severity of the lesions, pointing its role in cancer pathogenesis. White women presented twice the cervical lesions of mulatto and African origin women, although HPV infection rates were nearly the same for the three groups (approximately 50). Our results showed that HPV typing by in situ hybridization is a useful tool for distinguishing between low and high risk cervical lesions. Further studies are required to elucidate risk factors associated with HPV infection and progression to malignancy in Brazilian population.
Resumo:
Since 1984, DNA tests based on the highly repeated subtelomeric sequences of Plasmodium falciparum (rep 20) have been frequently used in malaria diagnosis. Rep 20 is very specific for this parasite, and is made of 21 bp units, organized in repeated blocks with direct and inverted orientation. Based in this particular organization, we selected a unique consensus oligonucleotide (pf-21) to drive a PCR reaction coupled to hybridization to non-radioactive labeled probes. The pf-21 unique oligo PCR (pf-21-I) assay produced DNA amplification fingerprints when was applied on purified P. falciparum DNA samples (Brazil and Colombia), as well as in patient's blood samples from a large area of Venezuela. The performance of the Pf-21-I assay was compared against Giemsa stained thick blood smears from samples collected at a malaria endemic area of the Bolívar State, Venezuela, at the field station of Malariología in Tumeremo. Coupled to non-radioactive hybridization the pf-21-I performed better than the traditional microscopic method with a r=1.7:1. In the case of mixed infections the r value of P. falciparum detection increased to 2.5:1. The increased diagnostic sensitivity of the test produced with this homologous oligonucleotide could provide an alternative to the epidemiological diagnosis of P. falciparum being currently used in Venezuela endemic areas, where low parasitemia levels and asymptomatic malaria are frequent. In addition, the DNA fingerprint could be tested in molecular population studies
Resumo:
SAMHD1 is a deoxynucleoside triphosphate triphosphohydrolase and a nuclease that restricts HIV-1 in noncycling cells. Germ-line mutations in SAMHD1 have been described in patients with Aicardi-Goutières syndrome (AGS), a congenital autoimmune disease. In a previous longitudinal whole genome sequencing study of chronic lymphocytic leukemia (CLL), we revealed a SAMHD1 mutation as a potential founding event. Here, we describe an AGS patient carrying a pathogenic germ-line SAMHD1 mutation who developed CLL at 24 years of age. Using clinical trial samples, we show that acquired SAMHD1 mutations are associated with high variant allele frequency and reduced SAMHD1 expression and occur in 11% of relapsed/refractory CLL patients. We provide evidence that SAMHD1 regulates cell proliferation and survival and engages in specific protein interactions in response to DNA damage. We propose that SAMHD1 may have a function in DNA repair and that the presence of SAMHD1 mutations in CLL promotes leukemia development.
Resumo:
The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp) sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.
Resumo:
DNA samples from blood and nasal swabs of 125 healthy household contacts was submitted to amplification by polymerase chain reaction (PCR) using a Mycobacterium leprae-specific sequence as a target for the detection of subclinical infection with M. leprae.All samples were submitted to hybridization analysis in order to exclude any false positive or negative results. Two positive samples were confirmed from blood out of 119 (1.7%) and two positive samples from nasal secretion out of 120 (1.7%). The analysis of the families with positive individuals showed that 2.5% (n = 3) of the contacts were relatives of multibacilary patients while 0.8% of the cases (n = 1) had a paucibacilary as an index case. All positive contacts were followed up and after one year none of them presented clinical signs of the disease. In spite of the PCR sensitivity to detect the presence of the M. leprae in a subclinical stage, this molecular approach did not seem to be a valuable tool to screen household contacts, since we determined a spurious association of the PCR positivity and further development of leprosy.
Resumo:
We performed a case-control study to determine the association of BK plasma viremia with hemorrhagic cystitis (HC) in hematopoietic cell transplant (HCT) recipients. Thirty cases of HC (14 of which occurred after platelet engraftment with documented BK viruria [BK-HC]) were compared with matched controls. Weekly plasma samples were tested for BK virus DNA by polymerase chain reaction (PCR). BK viremia detected before or during the disease was independently associated with HC (adjusted odds ratio = 30, P < .001); BK viremia was even important before clinical symptoms of HC occurred (odds ratio = 11, P < .001). Cases of HC and BK-HC had a significantly higher peak of BK plasma viral load than controls. BK virus was detected by in situ hybridization in bladder biopsies of 2 cases with severe HC and long-lasting BK viremia. BK virus seems to play a role in the development of HC and quantitative detection of BK DNA in plasma appears to be a marker of BK virus disease in HCT recipients.
Resumo:
BACKGROUND: Post-transplant lymphoproliferative disease (PTLD) is a life-threatening complication of immunosuppression following transplantation. Epstein-Barr virus (EBV) and gammopathy in serum are associated with PTLD, but these two parameters have not been evaluated in parallel for their association with PTLD. METHODS: We evaluated the incidence of EBV load positivity, gammopathy, and protein expression in sera from all PTLD patients diagnosed at our hospital during the past seven yr. Results were compared with those of a control group including matched transplanted patients who did not develop PTLD. RESULTS: Seven of 10 PTLD patients presented EBV(+) PTLD, for which five patients had detectable serum EBV DNA levels compared with none of 38 controls (RR between two groups =121, p < 0.0001). Five out of 10 patients had gammopathy at PTLD diagnosis compared with 5/38 controls (RR between two groups = 6.6, p = 0.022). Additionally, protein serum analysis by high-resolution two-dimensional gel electrophoresis and image examination failed to evidence specific abnormality in patients with PTLD compared with controls. CONCLUSIONS: Our results confirm an association between EBV in sera and gammopathy with PTLD, and highlight the high specificity of the former analysis. Whether a combination of both analyses will improve the clinical detection of PTLD remains to be evaluated in a larger prospective cohort study.
Resumo:
We have analyzed middle repetitive DNA in the albumin and vitellogenin gene families of Xenopus laevis. Mapping specific repetitive DNA sequences derived from introns of the A1 vitellogenin gene reveals that these sequences are scattered within and around the four vitellogenin genes (A1, A2, B1 and B2) and the two albumin genes (74 kd and 68 kd). Three repetitive DNA elements present in the A1 vitellogenin transcriptional unit are also located in introns of the 74 kd albumin gene. This apparently random distribution of middle repetitive DNA in the two gene families suggests that the analyzed sequences are not involved in gene regulation, but rather that they might represent unstable genetic elements. This hypothesis is further supported by the finding that size polymorphism in the A1 vitellogenin gene and in the 74 kd albumin gene is correlated with the presence or absence of repetitive DNA.
Resumo:
The detection of BK polyomavirus (BK virus, BKV) in kidney tissue is hampered by nonspecificity of antibodies suited to immunohistochemistry, and nonspecific background with in situ hybridization. The biotin-labeled DNA probe that is commercially available (Enzo Life Sciences, Inc.) shows good signal, but the intrinsic background in kidney tissue is high. We determined that the intrinsic background is due to endogenous biotin or biotin-binding activity in the renal tubular epithelium. Neither antibody blocking procedures nor an avidin/biotin block were entirely satisfactory for eliminating this background staining. We developed a digoxigenin-labeled DNA probe, and protocol, for detecting BK virus in formalin-fixed, paraffin embedded, kidney tissue obtained at autopsy. The hybridization signal is strong and there is no perceptible background staining. Eleven negative control kidneys all failed to hybridize. Conditions for low stringency hybridization may be employed, detecting both the related JC polyomavirus and BKV. Alternatively, high stringency hybridization conditions may be utilized, detecting BKV only. BK associated tubular necrosis is clearly demonstrated in two cases of BK nephritis.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.