991 resultados para DNA POLYMORPHISM


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Genetic structure of populations of Pissodes castaneus (De Geer) (Coleoptera, Curculionidae) using amplified fragment length polymorphism. The objective of this study was to determine the genetic structure of populations of Pissodes castaneus from different areas and on different species of Pinus using the PCR-AFLP technique. Twenty samples were analyzed, representing 19 populations from Brazil and one from Florence, Italy, which is the region of origin of P. castaneus. The four combinations of primers generated a total of 367 fragments of DNA, and 100% of polymorphic loci, indicating high degree of molecular polymorphism. The dendrogram did not reveal trends for grouping the populations in relation to origin. The low genetic similarity (0.11 between the most distant groups) and genetic distances of 0.13 and 0.44 for 10 out of the 20 samples may indicate several founding events or multiple introductions of heterogeneous strains into Brazil. The allelic fixation index (Fst) was 0.3851, considered high, and the number of migrants (Nm) was 0.3991, indicating low gene flow among populations. The highest genetic distances were between the population from Irani, SC and Cambará do Sul, RS and Bituruna, PR, indicating an independent founding event or a particular allelic fixation in the former location. The high genetic diversity among populations points out that the populations are genetically heterogeneous with a diverse gene pool in the surveyed areas, what makes them to respond differently to control measures.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Molecular species identification in mixed or contaminated biological material has always been problematic. We developed a simple and accurate method for mammal DNA identification in mixtures, based on interspecific mitochondrial DNA control region length polymorphism. Contrary to other published methods dealing with species mixtures, our protocol requires a single universal primer pair and amplification step, and is not based on a pre-defined panel of species. This protocol has been routinely employed by our laboratory for species identification in dozens of human and animal forensic caseworks. Six representative forensic caseworks involving the specific identification of mixed animal samples are reported in this paper, in order to demonstrate the applicability and usefulness of the method.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In many bird populations, individuals display one of several genetically inherited colour morphs. Colour polymorphism can be maintained by several mechanisms one of which being frequency-dependent selection with colour morphs signalling alternative mating strategies. One morph may be dominant and territorial, and another one adopt a sneaky behaviour to gain access to fertile females. We tested this hypothesis in the barn owl Tyto alba in which coloration varies from reddish-brown to white. This trait is heritable and neither sensitive to the environment in which individuals live nor to body condition. In Switzerland, reddish-brown males were observed to feed their brood at a higher rate and to produce more offspring than white males. This observation lead us to hypothesize that white males may equalise fitness by investing more effort in extra-pair copulations. This hypothesis predicts that lighter Coloured males produce more extra-pair young, have larger testes and higher levels of circulating testosterone. However, our results are not consistent with these three predictions. First, paternity analyses of 54 broods with a total of 211 offspring revealed that only one young was not sired by the male that was feeding it. Second, testes size was not correlated with male plumage coloration suggesting that white males are not sexually more active. Finally, in nestlings at the time of feather growth testosterone level was not related to plumage coloration suggesting that this androgen is not required for the expression of this plumage trait. Our study therefore indicates that in the barn owl colour polymorphism plays no role in the probability of producing extra-pair young.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Source/Description: SSCP analysis of intron 12 of the CFTR gene from PCR products showed an extra band in several DNA samples. Sequencing of the additional fragment extra band revealed a T- A change in the position 1898 + 152 of CFTR (Fig. 1). The change is a polymorphism which can be identified by SSCP or by BclI digestion...

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Source/Description: The probe used is a 98 bp fragment amplified by PCR from a cDNA clone of the CFTR gene or from genomic DNA corresponding to exon 10, using two primers from this exon (1)...

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The distribution of mitochondrial control region-sequence polymorphism was investigated in 15 populations of Crocidura russula along an altitudinal gradient in western Switzerland. High-altitude populations are smaller, sparser and appear to undergo frequent bottlenecks. Accordingly, they showed a loss of rare haplotypes, but unexpectedly, were less differentiated than lowland populations. Furthermore, the major haplotypes segregated significantly with altitude. The results were inconsistent with a simple model of drift and dispersal. They suggested instead a role for historical patterns of colonization, or, alternatively, present-day selective forces acting on one of the mitochondrial genes involved in metabolic pathways.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have analyzed middle repetitive DNA in the albumin and vitellogenin gene families of Xenopus laevis. Mapping specific repetitive DNA sequences derived from introns of the A1 vitellogenin gene reveals that these sequences are scattered within and around the four vitellogenin genes (A1, A2, B1 and B2) and the two albumin genes (74 kd and 68 kd). Three repetitive DNA elements present in the A1 vitellogenin transcriptional unit are also located in introns of the 74 kd albumin gene. This apparently random distribution of middle repetitive DNA in the two gene families suggests that the analyzed sequences are not involved in gene regulation, but rather that they might represent unstable genetic elements. This hypothesis is further supported by the finding that size polymorphism in the A1 vitellogenin gene and in the 74 kd albumin gene is correlated with the presence or absence of repetitive DNA.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A repeated DNA element in Xenopus laevis is described that is present in about 7500 copies dispersed throughout the genome. It was first identified in the 5' flanking region of one vitellogenin gene and was therefore named the Vi element. Seven copies are present within the vitellogenin gene region, three of them within introns of the genes A1, A2 and B2, and the other four copies in the gene flanking regions. Four of these copies have been sequenced. The Vi element is bounded by a well-conserved 13 base-pair inverted repeat; in addition, it is flanked by a three base-pair direct repeat that appears to be site-specific. The length of these four copies varies from 112 to 469 base-pairs; however, sequence homology between the different copies is very high. Their structural characteristics suggest that length heterogeneity may have arisen by either unequal recombinations, deletions or tandem duplications. Altogether, the characteristics and properties of the Vi element indicate that it might represent a mobile genetic element. One of the four copies sequenced is inserted close (position -535) to the transcription initiation site of the vitellogenin gene B2 in a region otherwise showing considerable homology with the closely related gene B1. Nevertheless, the presence of the Vi element does not seem to influence significantly the estrogen-controlled expression of gene B2. In addition, three alleles of this gene created by length polymorphism in intron 3 and in the Vi element inserted near the transcription initiation site are described.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The shrews of the Sorer araneus group have undergone a spectacular chromosome evolution. The karyotype of Sorer granarius is generally considered ancestral to those of Sorer coronatus and S. araneus. However, a sequence of 777 base pairs of the cytochrome b gene of the mitochondrial DNA (mtDNA) produces a quite different picture: S. granarius is closely related to the populations of S. araneus from the Pyrenees and from the northwestern Alps, whereas S. coronatus and S. araneus from Italy and the southern Alps represent two well-separated lineages. It is suggested that mtDNA and chromosomal evolution are in this case largely independant processes. Whereas mtDNA haplotypes are closely linked to the geographical history of the populations, chromosomal mutations were probably transmitted from one population to another. Available data suggest that the impressive chromosome polymorphism of this group is quite a recent phenomenon.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: The single nucleotide polymorphism (SNP) rs2542151 within the gene locus region encoding protein tyrosine phosphatase non-receptor type 2 (PTPN2) has been associated with Crohn's disease (CD), ulcerative colitis (UC), type-I diabetes, and rheumatoid arthritis. We have previously shown that PTPN2 regulates mitogen-activated protein kinase (MAPK) signaling and cytokine secretion in human THP-1 monocytes and intestinal epithelial cells (IEC). Here, we studied whether intronic PTPN2 SNP rs1893217 regulates immune responses to the nucleotide-oligomerization domain 2 (NOD2) ligand, muramyl-dipeptide (MDP). MATERIALS AND METHODS: Genomic DNA samples from 343 CD and 663 non-IBD control patients (male and female) from a combined German, Swiss, and Polish cohort were genotyped for the presence of the PTPN2 SNPs, rs2542151, and rs1893217. PTPN2-variant rs1893217 was introduced into T(84) IEC or THP-1 cells using a lentiviral vector. RESULTS: We identified a novel association between the genetic variant, rs1893217, located in intron 7 of the PTPN2 gene and CD. Human THP-1 monocytes carrying this variant revealed increased MAPK activation as well as elevated mRNA expression of T-bet transcription factor and secretion of interferon-γ in response to the bacterial wall component, MDP. In contrast, secretion of interleukin-8 and tumor necrosis factor were reduced. In both, T(84) IEC and THP-1 monocytes, autophagosome formation was impaired. CONCLUSIONS: We identified a novel CD-associated PTPN2 variant that modulates innate immune responses to bacterial antigens. These findings not only provide key insights into the effects of a functional mutation on a clinically relevant gene, but also reveal how such a mutation could contribute to the onset of disease.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The purpose of this study was to evaluate the association of the T309G MDM2 gene polymorphism with renal cell carcinoma (RCC) risk, pathology, and cancer-specific survival (CSS). T309G MDM2 was genotyped in 449 Caucasians, including 240 with RCC and 209 cancer-free controls. The T309G MDM2 genotype was TT in 174 (38.8%), GT in 214 (47.7%), and GG in 61 (13.6%) subjects, without any significant differences between cases and controls on both univariable (p=0.58) and multivariable logistic regression (each p>0.25). Furthermore, T309G MDM2 was not linked with T stage (p=0.75), N stage (p=0.37), M stage (p=0.94), grade (p=0.21), and subtype (p=0.55). There was, however, a statistically significant association of T309G MDM2 with CSS (p=0.022): patients with TT had significantly worse survival than GG/GT (p=0.009), while those with GT and GG had similar outcomes (p=0.92). The 5-year survival rate for patients with TT, GT, and GG was 69.5%, 84.5%, and 89.7%, respectively. On the multivariable analysis, T309G was identified as an independent prognostic factor. The T309G MDM2 polymorphism is an independent prognostic factor for patients with RCC, with the TT genotype being associated with worse prognosis. In this study, there were no significant associations with RCC risk and pathology.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

PURPOSE: To investigate the frequencies of polymorphic allele and genotypes for the LT-α gene, position +252 (rs909253), in Brazilian women with preeclampsia.METHODS: This is a case-control study, in which 30 women with preeclampsia, classified according to the criteria of the National High Blood Pressure Education Program, and 115 women in the control group, with at least two healthy pregnancies, were selected. Peripheral blood was collected, and DNA was extracted, followed by genotyping, using specific primers and restriction analysis. The genotypes obtained were AA, AG and GG. Statistical analysis was performed using the χ2association test. The Hardy-Weinberg Equilibrium was tested using the Haploview Program.RESULTS: The results showed no association between genotypes and preeclampsia development (χ2=2.0; p=0.4). When the AG and GG genotypes were grouped according to allele G presence or absence (genotype AA), the data showed that the presence of allele G was not significantly different between cases (women with preeclampsia) and controls (χ2=0.0; p=1.0). The LT-α gene polymorphism, position +252 (rs909253), seems not to be an important candidate for the development of preeclampsia. Other inflammatory genes should be researched, and studies involving gene-environment interactions should be performed, in order to reach a better understanding of the etiology of the preeclampsia.