969 resultados para Clonal chromosomal abnormalities
Resumo:
Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.
Resumo:
We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.
Resumo:
We recently generated a sodium sulphate cotransporter knock-out mouse (Nas1-/-) which has increased urinary sulphate excretion and hyposulphataemia. To examine the consequences of disturbed sulphate homeostasis in the modulation of mouse behavioural characteristics, Nas1-/- mice were compared with Nas1+/- and Nas1+/+ littermates in a series of behavioural tests. The Nas1-/- mice displayed significantly (P < 0.001) decreased marble burying behaviour (4.33 +/- 0.82 buried) when compared to Nas1+/+ (7.86 +/- 0.44) and Nas1+/- (8.40 +/- 0.37) animals, suggesting that Nas1-/- mice may have decreased object-induced anxiety. The Nas1-/- mice also displayed decreased locomotor activity by moving less distance (1.53 +/- 0.27 m, P < 0.05) in an open-field test when compared to Nas1+/+ (2.31 +/- 0.24 m) and Nas1+/- (2.15 +/- 0.19 m) mice. The three genotypes displayed similar spatiotemporal and ethological behaviours in the elevated-plus maze and open-field test, with the exception of a decreased defecation frequency by the Nas1-/- mice (40% reduction, P < 0.01). There were no significant differences between Nas1-/- and Nas1+/+ mice in a rotarod performance test of motor coordination and in the forced swim test assessing (anti-)depressant-like behaviours. This is the first study to demonstrate behavioural abnormalities in the hyposulphataemic Nas1-/- mice. (C) 2004 Elsevier B.V. All rights reserved.
Resumo:
High nutritional levels of iodine may induce a higher prevalence of autoimmune thyroiditis,hypothyroidism, goiter, as well as hyperthyroidism, mostly in the elderly. This study assessed thyroid volume and ultrasonographic abnormalities as well as urinary iodine excretion (UIE) in 964 schoolchildren living in an iodine-sufficient area in southern Brazil. Thyroid volume correlated with age and body surface area in boys and girls. In 76.8% of the children, UIE was above 300 mu g/l, with higher levels among boys compared to girls (484.2 mu g/l vs 435.3 mu g/l, p <0.001). Thyroid abnormalities detected by ultrasonography included hemiagenesis (0.5%), nodules (0.2%), cysts (0.7%), and hypoechogenicity (11.7%). Goiter was present in 1.9% of the children. Hypoechogenicity, a relevant marker of autoimmune thyroiditis, was the most common abnormality found in our study, and this may be linked to excessive iodine intake.
Resumo:
The term disorders of sex development (DSD) includes congenital conditions in which development of chromosomal, gonadal or anatomical sex is atypical. Mutations in genes present in X, Y or autosomal chromosomes can cause abnormalities of testis determination or disorders of sex differentiation leading to 46,XY DSD. Detailed clinical phenotypes allow the identification of new factors that can alter the expression or function of mutated proteins helping to understand new undisclosed biochemical pathways. In this review we present an update on 46,XY DSD aetiology, diagnosis and treatment based on extensive review of the literature and our three decades of experience with these patients.
Resumo:
Studies evaluating radiologic aspects, local complications, and structural alterations of the paranasal sinus in patients with mucosal leishmaniasis (ML) are lacking The aim of this study was to analyze alterations of the paranasal sinuses in patients with ML by using computed tomography (CT) scans This prospective study evaluated 26 patients in Brazil with ML Nom December 2008 through June 2009 All patients underwent CT scans of the paranasal sinuses Paranasal thickening was observed in 25 patients (96%) Nasal perforation was observed in 17 patients (65%) Those patients who received re-treatment showed more abnormalities on CT scan than cured patients (P < 0 05) Complications of ML are not limited to the nasal mucosa but extend to the paranasal sinuses. Mucosa! thickening. pacified air cells. bony remodeling, and bony thickening caused by inflammatory steals of the sinus cavity walls are CT findings suggestive of chronic sinusitis
Resumo:
Chronic obstructive pulmonary disease (COPD) is associated with osteoporosis and fragility fractures. The objectives of this study were to assess static and dynamic indices of cancellous and cortical bone structure in postmenopausal women with COPD. Twenty women with COPD who had not received chronic oral glucocorticoids underwent bone biopsies after double tetracycline labeling. Biopsies were analyzed by histomorphometry and mu CT and compared with age-matched controls. Distribution of the patients according to the Global Initiative for Chronic Obstructive Lung Disease (GOLD) was: Type I (15%), Type II (40%), Type III (30%), and Type IV (15%). Mean (+/-SD) cancellous bone volume (15.20 +/- 5.91 versus 21.34 +/- 5.53%, p = .01), trabecular number (1.31 +/- 0.26 versus 1.77 +/- 0.51/mm, p = .003), and trabecular thickness (141 +/- 23 versus 174 +/- 36 mu m, p = .006) were lower in patients than in controls. Connectivity density was lower in COPD (5.56 +/- 2.78 versus 7.94 +/- 3.08 mu m, p = .04), and correlated negatively with smoking (r = -0.67; p = .0005). Trabecular separation (785 +/- 183 versus 614 +/- 136 mu m, p = .01) and cortical porosity (4.11 +/- 1.02 versus 2.32 +/- 0.94 voids/mm(2); p < .0001) were higher in COPD while cortical width (458 +/- 214 versus 762 +/- 240 mu m; p < .0001) was lower. Dynamic parameters showed significantly lower mineral apposition rate in COPD (0.56 +/- 0.16 versus 0.66 +/- 0.12 mu m/day; p = .01). Patients with more severe disease, GOLD III and IV, presented lower bone formation rate than GOLDI and II (0.028 +/- 0.009 versus 0.016 +/- 0.011 mu m(3)/mu m(2)/day;p = 04). This is the first evaluation of bone microstructure and remodeling in COPD. The skeletal abnormalities seen in cancellous and cortical bone provide an explanation for the high prevalence of vertebral fractures in this disease. (C) 2010 American Society for Bone and Mineral Research.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Background Asbestosis is associated with lung cellular and immunological abnormalities. Induced sputum cytology and local and systemic markers of inflammation may be helpful to characterize disease status and progression in these patients. Methods Thirty-nine ex-workers with asbestosis on high-resolution CT (HRCT) and 21 non-exposed controls were evaluated. Sputum cytology and IL-8 in serum and sputum were related to lung function impairment. Results Subjects with asbestosis had reduced sputum cellularity but higher macrophagel neutrophil ratio and % macrophage as compared with controls. Sputum and serum IL-8 were also higher in patients with asbestosis (P < 0.05). In addition, evidence of lung architectural distorption on HRCT was associated with increased levels of serum IL-8. Interestingly, absolute macrophage number was negatively correlated with total lung capacity (r = -0.40; P = 0.04) and serum IL-8 to lung diffiusing capacity (r = -0.45; P = 0.01). Conclusions Occupationally exposed subjects with asbestosis on HRCT have cytologic abnormalities in induced sputum and increased local and systemic pro-inflammatory status which are correlated to functional impairment.
Resumo:
Background Pulmonary function tests (PFT), particularly spirometry and lung diffusing capacity for carbon monoxide (DL(CO)), have been considered useful methods for the detection of the progression of interstitial asbestos abnormalities as indicated by high-resolution computed tomography (HRCT). However, it is currently unknown which of these two tests correlates best with anatomical changes over time. Methods In this study, we contrasted longitudinal changes (3-9 years follow-up) in PFTs at rest and during exercise with interstitial abnormalities evaluated by HRCT in 63 ex-workers with mild-to-moderate asbestosis. Results At baseline, patients presented with low-grade asbestosis (Huuskonen classes I-II), and most PFT results were within the limits of normality. In the follow-up, most subjects had normal spirometry, static lung volumes and arterial blood gases. In contrast, frequency of DL(CO) abnormalities almost doubled (P < 0.05). Twenty-three (36.5%) subjects increased the interstitial marks on HRCT. These had significantly larger declines in DL(CO) compared to patients who remained stable (0.88 vs. 0.31 ml/min/mm Hg/year and 3.5 vs. 1.2%/year, respectively; P < 0.05). In contrast, no between-group differences were found for the other functional tests, including spirometry (P > 0.05). Conclusions These data demonstrate that the functional consequences of progression of HRCT abnormalities in mild-to-moderate asbestosis are better reflected by decrements in DL(CO) than by spirometric changes. These results might have important practical implications for medico-legal evaluation of this patient population. Am. J. Ind. Med. 54:185-193, 2011. (c) 2010 Wiley-Liss, Inc.
Resumo:
Exercise training has an important role in the prevention and treatment of hypertension, but its effects on the early metabolic and hemodynamic abnormalities observed in normotensive offspring of hypertensive parents (FH+) have not been studied. We compared high-intensity interval (aerobic interval training, AIT) and moderate-intensity continuous exercise training (CMT) with regard to hemodynamic, metabolic and hormonal variables in FH+ subjects. Forty-four healthy FH+ women (25.0+/-4.4 years) randomized to control (ConFH+) or to a three times per week equal-volume AIT (80-90% of VO(2MAX)) or CMT (50-60% of VO(2MAX)) regimen, and 15 healthy women with normotensive parents (ConFH-; 25.3+/-3.1 years) had their hemodynamic, metabolic and hormonal variables analyzed at baseline and after 16 weeks of follow-up. Ambulatorial blood pressure (ABP), glucose and cholesterol levels were similar among all groups, but the FH+ groups showed higher insulin, insulin sensitivity, carotid-femoral pulse wave velocity (PWV), norepinephrine and endothelin-1 (ET-1) levels and lower nitrite/ nitrate (NOx) levels than ConFH- subjects. AIT and CMT were equally effective in improving ABP (P<0.05), insulin and insulin sensitivity (P<0.001); however, AIT was superior in improving cardiorespiratory fitness (15 vs. 8%; P<0.05), PWV (P<0.01), and BP, norepinephrine, ET-1 and NOx response to exercise (P<0.05). Exercise intensity was an important factor in improving cardiorespiratory fitness and reversing hemodynamic, metabolic and hormonal alterations involved in the pathophysiology of hypertension. These findings may have important implications for the exercise training programs used for the prevention of inherited hypertensive disorder. Hypertension Research (2010) 33, 836-843; doi:10.1038/hr.2010.72; published online 7 May 2010
Resumo:
Purpose: To evaluate the changes over time in the pattern and extent of parenchymal abnormalities in asbestos-exposed workers after cessation of exposure and to compare 3 proposed semiquantitative methods with a careful side-by-side comparison of the initial and the follow-Lip computed tomography (CT) images. Materials and Methods: The study included 52 male asbestos workers (mean age SD, 62.2y +/- 8.2) who had baseline high-resolution CT after cessation of exposure and follow-up CT 3 to 5 years later. Two independent thoracic radiologists quantified the findings according to the scoring systems proposed by Huuskonen, Gamsu, and Sette and then did a side-by-side comparison of the 2 sets of scans without awareness of the dates of the CT scans. Results: There was no difference in the prevalence of the 2 most common parenchymal abnormalities (centrilobular small dotlike or branching opacities and interstitial lines) between the initial and follow-up CT scans. Honeycombing (20%) and traction bronchiectasis and bronchiolectasis (50%) were seen more commonly on the follow-up CT than on the initial examination (10% and 33%, respectively) (P = 0.01). Increased extent of parenchymal abnormalities was evident on side-by-side comparison in 42 (81%) patients but resulted in an increase in score in at least 1 semiquantitative system in only 16 (31%) patients (all P > 0.01, signed test). Conclusions: The majority of patients with previous asbestos exposure show evidence of progression of disease on CT at 3 to 5 years follow-up but this progression is usually not detected by the 3 proposed semiquantitative scoring schemes.
Resumo:
Objective: As part of a randomised double-blind study of a new atypical antipsychotic we sought to determine both the levels of visual acuity and the occurrence of toxic side-effects in a group of patients treated for many years on a variety of antipsychotics. Method: Twenty-three inpatients with a DSM-III-R diagnosis of chronic schizophrenia from two separate hospital locations who met the criteria for the double-blind trial were examined for ocular abnormalities at both baseline and at trial completion. Results: At baseline a high prevalence of abnormalities was identified: 19 patients (82.6%) were found to have one or more ocular abnormalities, including lens opacities/cataracts and corneal pigmentation; three patients, with delusions related to the sun, were noted to have solar burns; a high proportion (almost 70%) of patients had untreated visual acuity problems. No further changes were observed at the follow-up examinations. Conclusions: The possible causes of ocular disturbance in schizophrenia and the reasons for the relatively high ocular morbidity in this group are thought to result from both illness-related factors and the effects of antipsychotic medication. Causality is confounded by a number of issues such as the high prevalence of smoking, poor general health and the variety of antipsychotic medications used in the treatment of psychosis as well as substance abuse. The clinical implications are considered in this paper in relation to the move towards community-based psychiatric services.
Resumo:
Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.
Resumo:
To evaluate nosocomial infections due to imipenem-resistant and imipenem-susceptible Pseudomonas aeruginosa, a case-control study that included genotyping was performed. Hospitalization for more than 15 days was independently associated with infection with an imipenem-resistant organism. Sixty-seven percent of the imipenem-resistant isolates analyzed and 23% of the imipenem-susceptible isolates analyzed belonged to a single clone. Intervention led to a decrease in the number of infections due to imipenem-resistant and imipenem-susceptible P. aeruginosa.