Mapping of Diepoxybutane Damage in the Cytochrome b Domain of Mitochondrial DNA and the β-globin Domain of Nuclear Chicken DNA Using Quantitative PCR

Diepoxybutane (DEB), a known industrial carcinogen, reacts with DNA primarily at the N7 position of deoxyguanosine residues and creates interstrand cross-links at the sequence 5'-GNC. Since N7-N7 cross-links cause DNA to fragment upon heating, quantative polymerase chain reaction (QPCR) is being used in this experiment to measure the amount of DEB damage (lesion frequency) with three different targets-mitochondrial (unpackaged), open chromatin region, and closed chromatin region. Initial measurements of DEB damage within these three targets were not consistent because the template DNA was not the limiting reagent in the PCR. Follow-up PCR trials using a limiting amount of DNA are still in progress although initial experimentation looks promising. Sequencing of these three targets to confirm the primer targets has only been successfully performed for the closed chromatin target and does not match the sequence from NIH used to design that primer pair. Further sequencing trials need to be conducted on all three targets to assure that a mitochondrial, open chromatin, and closed chromatin region are actually being amplified in this experimental series.

Caracterização por susceptibilidade a antimicrobianos, PCR-ribotipificação e RAPD de Salmonella Enteritidis envolvidas em surtos de doenças veiculadas por alimentos ocorridas no Rio Grande do Sul, nos anos de 2001 e 2002

A Salmonella é uma das principais causas de doenças transmitidas por alimentos em todo o mundo, sendo que no Rio Grande do Sul ela tem sido apontada como o principal agente de toxinfecções alimentares nos últimos anos. Nesse trabalho, foram caracterizadas linhagens de Salmonella isoladas de alimentos envolvidos em Salmoneloses ocorridas no Rio Grande do Sul, no período de 2001 a 2002. Entre os 85 isolados investigados, 79 (93%) foram sorotipificados como S. Enteritidis, enquanto os outros seis isolados foram classificados como S. Javiana (n=1), S. Infantis (n=1), S. Agona (n=1), S. Typhimurium (n=1) e S. enterica subsp. enterica (1,4,5) (n=2). A resistência das amostras de S. Enteritidis a dez agentes antimicrobianos foi investigada. De modo geral, altas porcentagens de sensibilidade foram verificadas. As maiores porcentagens de resistência foram apresentadas em relação ao ácido nalidíxico (21,5%), à gentamicina (12,7%) e à estreptomicina (11,4%). A resistência a um ou mais antimicrobianos foi verificada em 30 amostras (37,97%), o que permitiu que os isolados fossem agrupados em 32 perfis de susceptibilidade. Apenas duas amostras apresentaram resistência múltipla a quatro drogas. Quando os isolados de S. Enteritidis foram submetidos à PCR-Ribotipificação, somente dois perfis (R1 e R2) foram identificados, sendo que o perfil R1 agrupou 92,4% dos isolados. . Os mesmos isolados também foram analisados por RAPD, sendo possível identificar quatro perfis de bandas (A a D). O perfil A agrupou 81% das amostras, enquanto os perfis B, C e D agruparam 9%, 5% e 5% dos isolados, respectivamente. Os resultados das análises de PCR-Ribotipificação e de RAPD sugerem que uma mesma linhagem de S. Enteritidis foi isolada a partir de alimentos envolvidos em Salmoneloses ocorridas em diferentes cidades do Estado durante o período de 2001 a 2002.

Análise de vacinas contra o sorotipo 3 do vírus da doença de marek por PCR em tempo real e cultivo celular.

A doença de Marek (MD), causada por um alfaherpesvírus, é uma enfermidade linfoproliferativa que acomete principalmente galinhas. Como não existe tratamento, a melhor forma de prevenção e controle da MD é através do uso de vacinas atenuadas, que vêm sendo usadas desde 1970. Este trabalho descreve a análise de vacinas vivas congeladas contra o sorotipo 3 do vírus da doença de Marek (herpesvírus de peru – HVT) por PCR em tempo real (qPCR) e por cultivo em células de embrião de galinha. Foram avaliadas três vacinas (cepa FC126) provenientes de distintos fabricantes. As análises da homogeneidade inter e intra-lote apresentaram, respectivamente, média ± desvio padrão de 2,6 ± 1,7%, 2,1 ± 1,1% e 1,2 ± 0,1% e média ± desvio padrão de 1,5 ± 0,1%, 1,2 ± 0,8% e 1,0 ± 0,3% para A, B e C, respectivamente. A qPCR subestimou os títulos das vacinas concentradas 4x e superestimou os títulos das vacinas diluídas 8x, enquanto o cultivo celular superestimou os títulos das vacinas concentradas. As vacinas apresentaram quantidades diferentes de células/dose e unidade formadoras de placa/dose. Conseqüentemente, a relação PFU/célula também foi diferente, o que demonstra a necessidade de construção de curvas diferentes, para cada fabricante, para a titulação por qPCR.

Diferenciação das espécies Cryptococcus neoformans e Cryptococcus gattii utilizando a metodologia de PCR multiplex e determinação do perfil epidemiológico de pacientes com meningite criptocócica

Cryptococcus neoformans é uma levedura oportunista que pode se alojar no sistema nervoso central causando meningite, meningoencefalite e encefalite principalmente em indivíduos com algum comprometimento do sistema imune. É responsável por 4,5% das infecções oportunistas que acometem pacientes portadores do Vírus da Imunodeficiência Humana (HIV-positivos). Cryptococcus gattii é um patógeno primário responsável por uma alta incidência de criptococomas no pulmão e no cérebro e que apresenta uma alta morbidez neurológica e uma resposta retardada à terapia antifúngica. O diagnóstico da criptococose é, atualmente, baseado na detecção da levedura em amostras clínicas, no cultivo com posterior identificação bioquímica e na pesquisa de antígenos circulantes. A diferenciação entre as espécies C. neoformans e C. gattii, na maioria dos laboratórios, é realizada utilizando o meio de cultura ágar canavanina-glicina-azul de bromotimol (CGB) e demora em torno de sete dias. Neste trabalho foi padronizada uma metodologia de PCR multiplex que pode vir a substituir as provas bioquímicas utilizadas atualmente para a identificação das espécies de Cryptococcus, reduzindo em 6 dias o tempo necessário para a identificação das espécies. A metodologia também se mostrou mais específica na identificação das espécies, concordando com os resultados das sorotipagens em todos os 132 isolados de Cryptococcus testados, enquanto o resultado obtido com o cultivo em ágar CGB foi discordante em 6 dos 132 isolados, sendo 5 falso-positivos e 1 falso negativo. Foi também realizado o primeiro estudo epidemiológico do perfil de pacientes com meningite criptocócica no estado do Rio Grande de Sul notificados no Laboratório Central de Saúde Pública IPB-LACEN/RS no período de 2000 a 2005. A maioria dos pacientes é do sexo masculino (77,12%), branco (83,5%), na faixa etária entre 30 a 39 anos (46,24%) e infectados pelo HIV (95%).

Serological investigation and PCR in detection of pathogenic leptospires in snakes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

In vitro culture, PCR , and nested PCR for the detection of Theileria equi in horses submitted to exercise

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Selection and validation of reference genes for gene expression studies by reverse transcription quantitative PCR in Xanthomonas citri subsp citri during infection of Citrus sinensis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Allelic Frequencies of HPA-1 to 5 Human Platelet Antigens in Patients Infected With Hepatitis C Virus

Studies have suggested that hepatitis C virus (HCV) may infect not only hepatocytes but may also be carried by platelets. Platelets express more than 20 polymorphic antigenic determinants on their surface, which are called human platelet antigens (HPA), To determine the allele frequency of the HPA-1 to -5 in patients infected with HCV, blood samples were collected from 257 blood donors for the control group and from 191 patients infected with HCV. DNA was isolated and amplified for genes HPA-1 to -4 using PCR Sequence Specific Primers (PCR-SSP) and HPA-5 using PCR-Restriction Fragment Length Polymorphism (PCR-RFLP). The allelic and genotypic frequency of HPA-5a in patients infected with HCV was found to be significantly lower(P < 0.05) than in the controls, and HPA-5b from patients infected with HCV was significantly higher (P < 0.05) than in controls. The increase in HPA5b allelic frequency in HCV infection may indicate a possible association between HCV infection and HPAs. J. Med. Virol. 81:757-759, 2009. (C) 2009 Wiley-Liss, Inc.

Hematological and cerebrospinal fluid changes in cattle naturally and experimentally infected with the bovine herpesvirus 5

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Accuracy of fetal gender determination in maternal plasma at 5 and 6 weeks of pregnancy

Objective To assess the viability of the early diagnosis of fetal gender in material plasma before 7 weeks of pregnancy by real-time polymerase chain reaction (real-time PCR), starting at 5 weeks of pregnancy.Method peripheral blood was collected from pregnant women, starting at 5 weeks of gestation. After centrifugation, plasma was separated for fetal DNA extraction. DNA was analyzed by quantitative real-time PCR for two genomic regions, one on the Y chromosome (DYS-14) and the other shared by both sexes (beta-globin), by the TaqMan Minor Groove Binder (MGB) probe assay. The results of the examinations were compared to fetal gender determined after delivery.Results A total of 79 examinations of fetal DNA in maternal plasma were performed for 52 pregnant women. Accuracy according to gestational age was 92.6% (25 of 27 cases) at 5 weeks, and 95.6% (22 of 23 cases) at 6 weeks. These results also demonstrate that fetal DNA is present at low concentrations in maternal plasma at 5 weeks (8.5 genome equivalents (GE)/mL) and 6 weeks (34.1 GE/mL) of pregnancy.Conclusion Quantitative real-time PCR and TaqMan MGB probes specific for the detection of fetal gender in maternal plasma starting at 5 weeks of gestation have good sensitivity and excellent specificity. Copyright (c) 2006 John Wiley & Sons, Ltd.

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

H19-DMR allele-specific methylation analysis reveals epigenetic heterogeneity of CTCF binding site 6 but not of site 5 in head-and-neck carcinomas: A pilot case-control analysis

Aberrant methylation of seven potential binding sites of the CTCF factor in the differentially methylated region upstream of the H19 gene (H19-DMR) has been suggested as critical for the regulation of IGF2 and H19 imprinted genes. In this study, we analyzed the allele-specific methylation pattern of CTCF binding sites 5 and 6 using methylationsensitive restriction enzyme PCR followed by RFLP analysis in matched tumoral and lymphocyte DNA from head-and-neck squamous cell carcinoma (HNSCC) patients, as well as in lymphocyte DNA from control individuals who were cancer-free. The monoallelic methylation pattern was maintained in CTCF binding site 5 in 22 heterozygous out of 91 samples analyzed. Nevertheless, a biallelic methylation pattern was detected in CTCF binding site 6 in a subgroup of HNSCC patients as a somatic acquired feature of tumor cells. An atypical biallelic methylation was also observed in both tumor and lymphocyte DNA from two patients, and at a high frequency in the control group (29 out of 64 informative controls). Additionally, we found that the C/T transition detected by HhaI RFLP suppressed one dinucleotide CpG in critical CTCF binding site 6, of a mutation showing polymorphic frequencies. Although a heterogeneous methylation pattern was observed after DNA sequencing modified by sodium bisulfite, the biallelic methylation pattern was confirmed in 9 out of 10 HNSCCs. These findings are likely to be relevant in the epigenetic regulation of the DMR, especially in pathological conditions in which the imprinting of IGF2 and H19 genes is disrupted.

Direct Detection of Mycobacterium bovis in Bovine Lymph Nodes by PCR

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)