986 resultados para X-ray anomalous scattering
Resumo:
Radial distribution function of CaCl2-KCl (1:2 mol) melt was measured by X-ray scattering of high temperature liquid. The nearest neighbour distances of Ca2+-Cl-, K+-Cl- and Cl--Cl- ionic pairs are 0.278, 0.306 and 0.380 nm, respectively, Discussion on the relation between structure and physicochemical properties in the melt was simply done in this paper.
Resumo:
The feasibility of applying the method of factor analysis to X-ray diffraction diagrams of binary blends of polypropylene and ethylene-propylene-diene terpolymer (PP/EPDM) was examined. The result of mathematical treatment was satisfactory. The number of scattering species and their concentrations in six kinds of PP/EPDM blends were determined. The separation of the spectral peaks of each species in the blends, contributing spectral intensities, was carried out.
Resumo:
The crystallinity of two series of uniform oligo(oxyethylene) mono-n-alkyl ethers has been investigated: alpha-alkyl,omega-hydroxyoligo(oxyethylene)s, H(CH2)n(OCH2CH2)mOH, and alpha-alkyl,omega-methoxyoligo(oxyethylene)s, H(CH2)n(OCH2CH2)mOCH3. The hydroxy-ended oligomers formed bilayer crystals, and the methoxy-ended oligomers formed monolayer crystals. The helical oxyethylene blocks were oriented normal to the layer-crystal end-group plane, whilst the trans-planar alkyl blocks were generally tilted at an angle delta = 60-degrees. The melting temperature and enthalpy of fusion were higher for hydroxy-ended oligomers than for corresponding methoxy-ended oligomers.
Resumo:
Material discrimination based on conventional or dual energy X-ray computed tomography (CT) imaging can be ambiguous. X-ray diffraction imaging (XDI) can be used to construct diffraction profiles of objects, providing new molecular signature information that can be used to characterize the presence of specific materials. Combining X-ray CT and diffraction imaging can lead to enhanced detection and identification of explosives in luggage screening. In this work we are investigating techniques for joint reconstruction of CT absorption and X-ray diffraction profile images of objects to achieve improved image quality and enhanced material classification. The initial results have been validated via simulation of X-ray absorption and coherent scattering in 2 dimensions.
Resumo:
X-ray spectra of the late-type star AB Dor obtained with the XMM-Newton satellite are analyzed. AB Dor was particularly active during the observations. An emission measure reconstruction technique is employed to analyze flare and quiescent spectra, with emphasis on the Fe XVII 15 - 17 angstrom wavelength region. The Fe XVII 16.78 angstrom/ 15.01 angstrom line ratio increases significantly in the hotter flare plasma. This change in the ratio is opposite to the theoretical predictions and is attributed to the scattering of 15.01 angstrom line photons from the line of sight. The escape probability technique indicates an optical depth of approximate to 0.4 for the 15.01 angstrom line. During the flare, the electron density is 4.4(-1.6)(+2.7) x 10(10) cm(-3), and the fractional Fe abundance is 0.5 +/- 0.1 of the solar photospheric value Using these parameters, a path length of approximate to 8000 km is derived. There is no evidence of opacity in the quiescent X-ray spectrum of the star.
Resumo:
We present near-infrared linear spectropolarimetry of a sample of persistent X-ray binaries, Sco X-1, Cyg X-2, and GRS 1915+105. The slopes of the spectra are shallower than what is expected from a standard steady state accretion disk, and can be explained if the near-infrared flux contains a contribution from an optically thin jet. For the neutron star systems, Sco X-1 and Cyg X-2, the polarization levels at 2.4 mu m are 1.3% +/- 0.10% and 5.4% +/- 0.7%, respectively, which is greater than the polarization level at 1.65 mu m. This cannot be explained by interstellar polarization or electron scattering in the anisotropic environment of the accretion flow. We propose that the most likely explanation is that this is the polarimetric signature of synchrotron emission arising from close to the base of the jets in these systems. In the black hole system GRS 1915+105 the observed polarization, although high (5.0% +/- 1.2% at 2.4 mu m), may be consistent with interstellar polarization. For Sco X-1 the position angle of the radio jet on the sky is approximately perpendicular to the near-infrared position angle (electric vector), suggesting that the magnetic field is aligned with the jet. These observations may be a first step toward probing the ordering, alignment, and variability of the outflow magnetic field in a region closer to the central accreting object than is observed in the radio band.
Resumo:
We present near-infrared linear spectropolarimetry of a sample of persistent X-ray binaries, Sco X-1, Cyg X-2 and GRS 1915+105. For Sco X-1 and Cyg X-2, the polarization levels at 2.4 µm are 1.3+/-0.10% and 5.4+/-0.7%, respectively, which is greater than the polarization level at 1.65 µm. This cannot be explained by interstellar polarization or electron scattering in the anisotropic environment of the accretion flow. We propose that the most likely explanation is that this is the polarimetric signature of synchrotron emission arising from close to the base of the jet. For Sco X-1 the position angle of the radio jet on the sky is approximately perpendicular to the near-infrared position angle (electric vector), suggesting that the magnetic field is aligned with the jet. These observations may be a first step towards probing the ordering, alignment, and variability of the outflow magnetic field, in a region closer to the central accreting object than is observed in the radio band.
Resumo:
We perform multidimensional radiative transfer simulations to compute spectra for a hydrodynamical simulation of a line-driven accretion disc wind from an active galactic nucleus. The synthetic spectra confirm expectations from parametrized models that a disc wind can imprint a wide variety of spectroscopic signatures including narrow absorption lines, broad emission lines and a Compton hump. The formation of these features is complex with contributions originating from many of the different structures present in the hydrodynamical simulation. In particular, spectral features are shaped both by gas in a successfully launched outflow and in complex flows where material is lifted out of the disc plane but ultimately falls back. We also confirm that the strong Fe Ka line can develop a weak, red-skewed line wing as a result of Compton scattering in the outflow. In addition, we demonstrate that X-ray radiation scattered and reprocessed in the flow has a pivotal part in both the spectrum formation and determining the ionization conditions in the wind. We find that scattered radiation is rather effective in ionizing gas which is shielded from direct irradiation from the central source. This effect likely makes the successful launching of a massive disc wind somewhat more challenging and should be considered in future wind simulations. © 2010 The Authors. Journal compilation © 2010 RAS.
Resumo:
We use a multidimensional Monte Carlo code to compute X-ray spectra for a variety of active galactic nucleus (AGN) disc-wind outflow geometries. We focus on the formation of blueshifted absorption features in the Fe K band and show that line features similar to those which have been reported in observations are often produced for lines of sight through disc-wind geometries. We also discuss the formation of other spectral features in highly ionized outflows. In particular, we show that, for sufficiently high wind densities, moderately strong Fe K emission lines can form and that electron scattering in the flow may cause these lines to develop extended red wings. We illustrate the potential relevance of such models to the interpretation of real X-ray data by comparison with observations of a well-known AGN, Mrk 766. Journal compilation © 2008 RAS.
Resumo:
Ultraviolet and X-ray observations show evidence of outflowing gas around many active galactic nuclei. It has been proposed that some of these outflows are driven off gas infalling towards the central supermassive black hole. We perform radiative transfer calculations to compute the gas ionization state and the emergent X-ray spectra for both two- and three-dimensional (3D) hydrodynamical simulations of this outflow-from-inflow scenario. By comparison with observations, our results can be used to test the theoretical models and guide future numerical simulations. We predict both absorption and emission features, most of which are formed in a polar funnel of relatively dense (10 -10 g cm ) outflowing gas. This outflow causes strong absorption for observer orientation angles of ?35°. Particularly in 3D, the strength of this absorption varies significantly for different lines of sight owing to the fragmentary structure of the gas flow. Although infalling material occupies a large fraction of the simulation volume, we do not find that it imprints strong absorption features in the X-ray spectra since the ionization state is predicted to be very high. Thus, an absence of observed inflow absorption features does not exclude the models. The main spectroscopic consequence of the infalling gas is a Compton-scattered continuum component that partially re-fills the absorption features caused by the outflowing polar funnel. Fluorescence and scattering in the outflow are predicted to give rise to several emission features including a multicomponent Fe Ka emission complex for all observer orientations. For the hydrodynamical simulations considered, we predict both ionization states and column densities for the outflowing gas that are too high to be quantitatively consistent with well-observed X-ray absorption systems. Nevertheless, our results are qualitatively encouraging and further exploration of the model parameter space is warranted. Higher resolution hydrodynamic simulations are needed to determine whether the outflows fragment on scales unresolved in our current study, which may yield the denser lower ionization material that could reconcile the models and the observations. © 2012 The Authors Monthly Notices of the Royal Astronomical Society © 2012 RAS.
Resumo:
Context: Mg VIII emission lines are observed in a range of astronomical objects such as the Sun, other cool stars and in the coronal line region of Seyfert galaxies. Under coronal conditions Mg VIII emits strongly in the extreme ultraviolet (EUV) and soft X-ray spectral regions which makes it an ideal ion for plasma diagnostics.
Aims. Two theoretical atomic models, consisting of 125 fine structure levels, are developed for the Mg VIII ion. The 125 levels arise from the 2s(2)2p, 2s(2)p2, 2p(3), 2s(2)3s, 2s(2)3p, 2s(2)3d, 2s2p3s, 2s2p3p, 2s2p3d, 2p(2)3s, 2p(2)3p and 2p(2)3d configurations. Electron impact excitation collision strengths and radiative transition probabilities are calculated for both Mg VIII models, compared with existing data, and the best model selected to generate a set of theoretical emission line intensities. The EUV lines, covering 312-790 angstrom, are compared with existing solar spectra (SERTS-89 and SUMER), while the soft X-ray transitions (69-97 angstrom) are examined for potential density diagnostic line ratios and also compared with the limited available solar and stellar observational data.
Methods. The R-matrix codes Breit-Pauli RMATRXI and RMATRXII are utilised, along with the PSTGF code, to calculate the collision strengths for two Mg VIII models. Collision strengths are averaged over a Maxwellian distribution to produce the corresponding effective collision strengths for use in astrophysical applications. Transition probabilities are also calculated using the CIV3 atomic structure code. The best data are then incorporated into the modelling code CLOUDY and line intensities generated for a range of electron temperatures and densities appropriate to solar and stellar coronal plasmas.
Results. The present effective collision strengths are compared with two previous calculations. Good levels of agreement are found with the most recent, but there are large differences with the other for forbidden transitions. The resulting line intensities compare favourably with the observed values from the SERTS-89 and SUMER spectra. Theoretical soft X-ray emission lines are presented and several density diagnostic line ratios examined, which are in reasonable agreement with the limited observational data available.
Resumo:
A method is presented for determining the composition of thin films containing the elements Bi, Sr, Br, Cu, and Ca. Quantitative x-ray fluorescence (XRF) consisting of radioactive sources (secondary foil excitor 241Am-Mo source and 55Pe source), a Si(Li) detector, and a multichannel analyzer were employed. The XRF system was calibrated by using sol gel thin films of known element composition and also by sputtered thin films analyzed by the conventional Rutherford Back Scattering (RBS). The XRF system has been used to assist and optimize the sputter target composition required to produce high-Tc BiSrCaCuO films with the desired metal composition.
Resumo:
Energies of muonic X-rays of the K-series of carbon, nitrogen and oxygen have been measured with an accuracy of about 15 eV. Root mean square radii of the nuclear charge distributions were deduced. The results 2.49±0.05 fm for carbon, 2.55 ±0.03 fm for nitrogen and 2.71 ±0.02 fm for oxygen are in good agreement at comparable accuracy with recent electron scattering data.
Resumo:
La investigació que es presenta en aquesta tesi es centra en l'aplicació i millora de metodologies analítiques existents i el desenvolupament de nous procediments que poden ser utilitzats per a l'estudi dels efectes ambientals de la dispersió dels metalls entorn a les zones mineres abandonades. En primer lloc, es van aplicar diferents procediments d'extracció simple i seqüencial per a estudiar la mobilitat, perillositat i bio-disponibilitat dels metalls continguts en residus miners de característiques diferents. Per altra banda, per a estudiar les fonts potencials de Pb en la vegetació de les zones mineres d'estudi, una metodologia basada en la utilització de les relacions isotòpiques de Pb determinades mitjançant ICP-MS va ser avaluada. Finalment, tenint en compte l'elevat nombre de mostres analitzades per a avaluar l'impacte de les activitats mineres, es va considerar apropiat el desenvolupament de mètodes analítics d'elevada productivitat. En aquest sentit la implementació d'estratègies quantitatives així com l'aplicació de les millores instrumentals en els equips de XRF han estat avaluades per a aconseguir resultats analítics fiables en l'anàlisi de plantes. A més, alguns paràmetres de qualitat com la precisió, l'exactitud i els límits de detecció han estat curosament determinats en les diverses configuracions de espectròmetres de XRF utilitzats en el decurs d'aquest treball (EDXRF, WDXRF i EDPXRF) per a establir la capacitat de la tècnica de XRF com a tècnica alternativa a les clàssiques comunament aplicades en la determinació d'elements en mostres vegetals.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.