Understanding of auditory discourse in older adults: the effects of syntax and working memory

Background: As people age, language-processing ability changes. While several factors modify discourse comprehension ability in older adults, syntactic complexity of auditory discourse has received scant attention. This is despite the widely researched domain of syntactic processing of single sentences in older adults. Aims: The aims of this study were to investigate the ability of healthy older adults to understand stories that differed in syntactic complexity, and its relation to working memory. Methods & Procedures: A total of 51 healthy adults (divided into three age groups) took part. They listened to brief stories (syntactically simple and syntactically complex) and had to respond to false/true comprehension probes following each story. Working memory capacity (digit span, forward and backward) was also measured. Outcomes & Results: Differences were found in the ability of healthy older adults to understand simple and complex discourse. The complex discourse in particular was more sensitive in discerning age-related language patterns. Only the complex discourse task correlated moderately with age. There was no correlation between age and simple discourse. As far as working memory is concerned, moderate correlations were found between working memory and complex discourse. Education did not correlate with discourse, neither simple, nor complex. Conclusions: Older adults may be less efficient in forming syntactically complex representations and this may be influenced by limitations in working memory.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Small wars in the age of Clausewitz: the watershed between partisan war and people's war

Around the time of Clausewitz’s writing, a new element was introduced into partisan warfare: ideology. Previously, under the ancien régime, partisans were what today we would call special forces, light infantry or cavalry, almost always mercenaries, carrying out special operations, while the main action in war took place between regular armies. Clausewitz lectured his students on such ‘small wars’. In the American War of Independence and the resistance against Napoleon and his allies, operations carried out by such partisans merged with counter-revolutionary, nationalist insurgencies, but these Clausewitz analysed in a distinct category, ‘people's war’. Small wars, people's war, etc. should thus not be thought of as monopoly of either the political Right or the Left.

Shakespeare and Islam

This special issue conceives of “Shakespeare and Islam” in its broadest sense, conceptually, and opens up the conjunction to consideration of both the early modern and more recent periods. It is not directly concerned with addressing doctrinal questions: “Islam” is a flag of convenience for our purposes, an umbrella term that takes in not only the Ottoman Empire but also the Persian (a subject that, perhaps unsurprisingly, tends to be overshadowed by its stronger neighbour), and extends to a discussion of twentieth- and twenty-first-century issues of Shakespearean interpretation. In line with this journal's principal remit, the essays concentrate on questions of staging and interpretation, adaptation and appropriation, thus drawing on and contributing to one of the dominant fields of Shakespeare studies today. While the early modern period remains the collection's central interest, two concluding essays remind us (if we need reminding) that the seemingly endless recycling and reinterpretation of Shakespeare have implications for how we understand the conjunction with Islam today.