Sequence effects in structures of the dinucleotides d-pApT AND d-pTpA

The H1',H2' and H2″ regions of the 270-MHz PMR spectra of two deoxydinucleotides, d-pTpA and d-pApT, have been analyzed. The coupling constants in the sugar ring indicate that both A and T sugars have a tendency to acquire 2E conformations. There is also a marginal difference in the 2E populations of the T sugar in the two dinucleotides. The trends in the chemical shifts of base protons indicate different stacking of the bases in d-pApT and d-pTpA. The sequence effects on base stacking and pentose conformation are discussed.

The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1

While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1).

Sequence-dependent molecular conformation of polynucleotides: right and left-handed helices

Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.

The averaging principle and the diagram technique

Rae and Davidson have found a striking connection between the averaging method generalised by Kruskal and the diagram technique used by the Brussels school in statistical mechanics. They have considered conservative systems whose evolution is governed by the Liouville equation. In this paper we have considered a class of dissipative systems whose evolution is governed not by the Liouville equation but by the last-multiplier equation of Jacobi whose Fourier transform has been shown to be the Hopf equation. The application of the diagram technique to the interaction representation of the Jacobi equation reveals the presence of two kinds of interactions, namely the transition from one mode to another and the persistence of a mode. The first kind occurs in the treatment of conservative systems while the latter type is unique to dissipative fields and is precisely the one that determines the asymptotic Jacobi equation. The dynamical equations of motion equivalent to this limiting Jacobi equation have been shown to be the same as averaged equations.

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Phase diagram of vortex matter in layered superconductors with tilted columnar pinning centers

We study the vortex matter phase diagram of a layered superconductor in the presence of columnar pinning defects, tilted with respect to the normal to the layers. We use numerical minimization of the free energy written as a functional of the time-averaged vortex density of the Ramakrishnan-Yussouff form, supplemented by the appropriate pinning potential. We study the case where the pin density is smaller than the areal vortex density. At lower pin concentrations, we find, for temperatures of the order of the melting temperature of the unpinned lattice, a Bose glass type phase which at lower temperatures converts, via a first-order transition, to a Bragg glass, while, at higher temperatures, it crosses over to an interstitial liquid. At somewhat higher concentrations, no transition to a Bragg glass is found even at the lowest temperatures studied. While qualitatively the behavior we find is similar to that obtained using the same procedures for columnar pins normal to the layers, there are important and observable quantitative differences, which we discuss.

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Characterization of sequence and structural features of the Candida krusei Enolase

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

A common epitope of beta-lactoglobulin and serum retinol-binding proteins: Elucidation of its core sequence using synthetic peptides

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.