Doppler lidar measurements of oriented planar ice crystals falling from supercooled and glaciated layer clouds

The properties of planar ice crystals settling horizontally have been investigated using a vertically pointing Doppler lidar. Strong specular reflections were observed from their oriented basal facets, identified by comparison with a second lidar pointing 4° from zenith. Analysis of 17 months of continuous high-resolution observations reveals that these pristine crystals are frequently observed in ice falling from mid-level mixed-phase layer clouds (85% of the time for layers at −15 °C). Detailed analysis of a case study indicates that the crystals are nucleated and grow rapidly within the supercooled layer, then fall out, forming well-defined layers of specular reflection. From the lidar alone the fraction of oriented crystals cannot be quantified, but polarimetric radar measurements confirmed that a substantial fraction of the crystal population was well oriented. As the crystals fall into subsaturated air, specular reflection is observed to switch off as the crystal faces become rounded and lose their faceted structure. Specular reflection in ice falling from supercooled layers colder than −22 °C was also observed, but this was much less pronounced than at warmer temperatures: we suggest that in cold clouds it is the small droplets in the distribution that freeze into plates and produce specular reflection, whilst larger droplets freeze into complex polycrystals. The lidar Doppler measurements show that typical fall speeds for the oriented crystals are ≈ 0.3 m s−1, with a weak temperature correlation; the corresponding Reynolds number is Re ∼ 10, in agreement with light-pillar measurements. Coincident Doppler radar observations show no correlation between the specular enhancement and the eddy dissipation rate, indicating that turbulence does not control crystal orientation in these clouds. Copyright © 2010 Royal Meteorological Society

The photodimerisation of the alpha- and beta-forms of trans-cinnamic acid: a study of single crystals by vibrational microspectroscopy

Infrared and Raman microspectroscopy have been used to follow the photodimerisation reactions of single crystals, the alpha- and beta-forms of trans-cinnamic acid. This approach allows the starting materials and products -alpha-truxillic acid that has C-i symmetry and beta-truxinic acid, which has C-s symmetry-to be identified. It also allows the topotactic nature of the reaction to be confirmed. Attempts to produce the poorly-defined unreactive gamma-form of trans-cinnamic acid resulted only in a mixture of the alpha- and beta-forms. The findings suggest a wide role for these spectroscopic methods in monitoring solid-state organic reactions. (C) 2002 Elsevier Science B.V. All rights reserved.

Stepwise self-assembly of a tripeptide from molecular dimers to supramolecular beta-sheets in crystals and amyloid-like fibrils in the solid state

The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Nematic and columnar ordering of a PEG-peptide conjugate in aqueous solution

The self-assembly in aqueous solution of a PEG-peptide conjugate is studied by spectroscopy, electron microscopy, rheology and small-angle Xray and neutron scattering (SAXS and SANS). The peptide fragment, FFKLVFF is based on fragment KLVFF of the amyloid beta-peptide, A beta(16-20), extended by two hydrophobic phenylalanine units. This is conjugated to PEG which confers water solubility and leads to distinct self-assembled structures. Small-angle scattering reveals the formation of cylindrical fibrils comprising a peptide core and PEG corona. This constrained structure leads to a model parallel beta-sheet self-assembled structure with a radial arrangement of beta sheets. Oil increasing concentration, successively nematic and hexagonal columnar phases are formed. The flow-induced alignment of both structures was studied in situ by SANS using a Couette cell. Shear-induced alignment is responsible for the shear thinning behaviour observed by dynamic shear rheometry. Incomplete recovery of moduli after cessation of shear is consistent with the observation from SANS of retained orientation in the sample.

Gas-solid reactions of single crystals: a study of reactions of NH3 and NO2 with single crystalline organic substrates by infrared microspectroscopy

Reaction of single crystals of benzoic and trans-cinnamic acids with 200 Torr pressure of ammonia gas in a sealed glass bulb at 20 degrees C generates the corresponding ammonium salts; there is no sign of any 1:2 adduct as has been reported previously for related systems. Isotopic substitution using ND3 has been used to aid identification of the products. Adipic acid likewise reacts with NH3 gas to form a product in which ammonium salts are formed at both carboxylic acid groups. Reaction of 0.5 Torr pressure of NO2 gas with single crystals of 9-methylanthracene and 9-anthracenemethanol in a flow system generates nitrated products where the nitro group appears to be attached at the 10-position, i.e. the position trans to the methyl or methoxy substituent on the central ring. Isotopic substitution using (NO2)-N-15 has been used to confirm the identity of the bands arising from the coordinated NO2 group. The products formed when single crystals of hydantoin are reacted with NO2 gas under similar conditions depend on the temperature of the reaction. At 20 degrees C, a nitrated product is formed, but at 65 degrees C this gives way to a product containing no nitro groups. The findings show the general applicability of infrared microspectroscopy to a study of gas-solid reactions of organic single crystals. (c) 2005 Elsevier B.V. All rights reserved.

Gas-solid reactions of single crystals: a study of the reaction of bromine with single crystals of trans-cinnamic acid and a range of its derivatives by infrared and Raman microspectroscopy

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Effects of composition on fat rheology and crystallisation

The crystallisation behaviour of three fat blends, comprising a commercial shortening, a blend of fats with a very low trans fatty acid content ("low-trans") and a blend including hardened rapeseed oil with a relatively high trans fatty acid content ("high-trans") was studied. Molten fats were lowered to a temperature of 31 degrees C and stirred for 0, 15, 30, 45 and 60 min. Samples were removed and their rheological properties studied, using a controlled stress rheometer, employing a frequency sweep procedure. Effects of the progressive crystallisation at 31 degrees C on the melting profile of fat samples removed from the stirred vessel and solidified at -20 degrees C were also studied by differential scanning calorimetry (DSC). The rheological profiles obtained suggested that all of the fats studied had weak viscoelastic "liquid" structures when melted, but these changed to structures perceived by the rheometer as weak viscoelastic "gels" in the early stages of crystallisation (G' (storage modulus) > G" (loss modulus) over most of the measured frequency range). These subsequently developed into weak viscoelastic semi-solids, showing frequency dependent behaviour on further crystallisation. These changes in behaviour were interpreted as changes from a small number of larger crystals "cross-linking" in a liquid matrix to a larger number of smaller crystals packed with a "slip plane" of liquid oil between them. The rate of crystallisation of the three fats was in the order high trans > low-trans > commercial shortening. Changes in the DSC melting profile due to fractionation of triacylglycerols during the crystallisation at 31 degrees C were evident for all three fats. (c) 2006 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Mechanistic insights into a gas–solid reaction in molecular crystals: the role of hydrogen bonding

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.