999 resultados para Repetitive Dna


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transposons of the Mutator superfamily have been widely described in plants, but only recently have metazoan organisms been shown to harbour them. In this work we describe novel Mutator superfamily transposons from the genomes of the human parasites Schistosoma mansoni and S. japonicum, which we name Curupira-1 and Curupira-2. Curupira elements do not have Terminal Inverted Repeats (TIRs) at their extremities and generate Target Site Duplications (TSDs) of 9 base pairs. Curupira-2 transposons code for a conserved transposase and SWIM zinc finger domains, while Curupira-1 elements comprise these same domains plus a WRKY zinc finger. Alignment of transcript sequences from both elements back to the genomes indicates that they are subject to splicing to produce mature transcripts. Phylogenetic analyses indicate that these transposons represent a new lineage of metazoan Mutator-like elements with characteristics that are distinct from the recently described Phantom elements. Description of these novel schistosome transposons provides new insights in the evolution of transposable elements in schistosomes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp) sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The use of molecular tools for genotyping Mycobacterium tuberculosis isolates in epidemiological surveys in order to identify clustered and orphan strains requires faster response times than those offered by the reference method, IS6110 restriction fragment length polymorphism (RFLP) genotyping. A method based on PCR, the mycobacterial interspersed repetitive-unit-variable-number tandem-repeat (MIRU-VNTR) genotyping technique, is an option for fast fingerprinting of M. tuberculosis, although precise evaluations of correlation between MIRU-VNTR and RFLP findings in population-based studies in different contexts are required before the methods are switched. In this study, we evaluated MIRU-VNTR genotyping (with a set of 15 loci [MIRU-15]) in parallel to RFLP genotyping in a 39-month universal population-based study in a challenging setting with a high proportion of immigrants. For 81.9% (281/343) of the M. tuberculosis isolates, both RFLP and MIRU-VNTR types were obtained. The percentages of clustered cases were 39.9% (112/281) and 43.1% (121/281) for RFLP and MIRU-15 analyses, and the numbers of clusters identified were 42 and 45, respectively. For 85.4% of the cases, the RFLP and MIRU-15 results were concordant, identifying the same cases as clustered and orphan (kappa, 0.7). However, for the remaining 14.6% of the cases, discrepancies were observed: 16 of the cases clustered by RFLP analysis were identified as orphan by MIRU-15 analysis, and 25 cases identified as orphan by RFLP analysis were clustered by MIRU-15 analysis. When discrepant cases showing subtle genotypic differences were tolerated, the discrepancies fell from 14.6% to 8.6%. Epidemiological links were found for 83.8% of the cases clustered by both RFLP and MIRU-15 analyses, whereas for the cases clustered by RFLP or MIRU-VNTR analysis alone, links were identified for only 30.8% or 38.9% of the cases, respectively. The latter group of cases mainly comprised isolates that could also have been clustered, if subtle genotypic differences had been tolerated. MIRU-15 genotyping seems to be a good alternative to RFLP genotyping for real-time interventional schemes. The correlation between MIRU-15 and IS6110 RFLP findings was reasonable, although some uncertainties as to the assignation of clusters by MIRU-15 analysis were identified.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coxiella burnetii is the agent of Q fever , an emergent worldwide zoonosis of wide clinical spectrum. Although C. burnetii infection is typically associated with acute infection, atypical pneumonia and flu-like symptoms, endocarditis, osteoarticular manifestations and severe disease are possible, especially when the patient has a suppressed immune system; however, these severe complications are typically neglected. This study reports the sequencing of the repetitive element IS1111 of the transposase gene of C. burnetii from blood and bronchoalveolar lavage (BAL) samples from a patient with severe pneumonia following methotrexate therapy, resulting in the molecular diagnosis of Q fever in a patient who had been diagnosed with active seronegative polyarthritis two years earlier. To the best of our knowledge, this represents the first documented case of the isolation of C. burnetii DNA from a BAL sample.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Starting from a biologically active recombinant DNA clone of exogenous unintegrated GR mouse mammary tumor virus, we have generated three subclones of PstI fragments of 1.45, 1.1, and 2.0 kb in the plasmid vector PBR322. The nucleotide sequence has been determined for the clone of 1.45 kb which includes almost the complete region of the long terminal repeat (LTR) plus an adjacent stretch of unique sequence DNA. A short region of the 2.0 kb clone, containing the beginning of the LTR, has also been sequenced. Starting with the A of an initiation codon outside the LTR, we detected an open reading frame of 960 nucleotides, potentially coding for a protein of 320 amino acids (36K). Two hundred nucleotides downstream from the termination codon, and approximately 25 nucleotides upstream from the presumptive initiation site of viral RNA synthesis, we found a promoter-like sequence. The sequence AGTAAA was detected approximately 15-20 nucleotides upstream from the 3' end of virion RNA and probably serves as a polyadenylation signal. The 1.45 kb PstI fragment has been transfected into Ltk- cells together with a plasmid containing the thymidine kinase gene of herpes simplex virus. The virus-specific RNA synthesis detected in a Tk+ cell clone was strongly stimulated by the addition of dexamethasone.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The three subtypes of the peroxisome proliferator-activated receptors (PPARalpha, beta/delta, and gamma) form heterodimers with the 9-cis-retinoic acid receptor (RXR) and bind to a common consensus response element, which consists of a direct repeat of two hexanucleotides spaced by one nucleotide (DR1). As a first step toward understanding the molecular mechanisms determining PPAR subtype specificity, we evaluated by electrophoretic mobility shift assays the binding properties of the three PPAR subtypes, in association with either RXRalpha or RXRgamma, on 16 natural PPAR response elements (PPREs). The main results are as follows. (i) PPARgamma in combination with either RXRalpha or RXRgamma binds more strongly than PPARalpha or PPARbeta to all natural PPREs tested. (ii) The binding of PPAR to strong elements is reinforced if the heterodimerization partner is RXRgamma. In contrast, weak elements favor RXRalpha as heterodimerization partner. (iii) The ordering of the 16 natural PPREs from strong to weak elements does not depend on the core DR1 sequence, which has a relatively uniform degree of conservation, but correlates with the number of identities of the 5'-flanking nucleotides with respect to a consensus element. This 5'-flanking sequence is essential for PPARalpha binding and thus contributes to subtype specificity. As a demonstration of this, the PPARgamma-specific element ARE6 PPRE is able to bind PPARalpha only if its 5'-flanking region is exchanged with that of the more promiscuous HMG PPRE.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A total of 189 Candida albicans isolates have been typed by multilocus enzyme electrophoresis. The results obtained confirm the clonal mode of reproduction of C. albicans. The C. albicans populations found in the oropharynx of human immunodeficiency virus (HIV)-infected patients, in the oropharynx of healthy carriers, or in association with invasive candidiasis could not be distinguished. No clone or group of clones could be associated with the appearance of clinical disorders or with a reduced in vitro susceptibility to the antifungal agent fluconazole. Multiple and sequential oral isolates from 24 HIV-infected patients were also typed by restriction enzyme analysis with the enzymes EcoRI and HinfI and by use of the Ca3 repetitive probe. The results obtained by the combination of all three typing methods show that all but one patient each carried a unique major C. albicans clone in their oropharynx. The 21 patients with sequential isolates had the same C. albicans clones in their throats during recurrent oropharyngeal candidiasis episodes, independently of clinical status or of changes of in vitro susceptibility to fluconazole. Finally, several isolates of the same C. albicans clone found simultaneously in the oropharynx of a patient may present different levels of susceptibility to fluconazole.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The process of DNA strand exchange during general genetic recombination is initiated within protein-stabilized synaptic filaments containing homologous regions of interacting DNA molecules. The RecA protein in bacteria and its analogs in eukaryotic organisms start this process by forming helical filamentous complexes on single-stranded or partially single-stranded DNA molecules. These complexes then progressively bind homologous double-stranded DNA molecules so that homologous regions of single- and double-stranded DNA molecules become aligned in register while presumably winding around common axis. The topological assay presented herein allows us to conclude that in synaptic complexes containing homologous single- and double-stranded DNA molecules, all three DNA strands have a helicity of approximately 19 nt per turn.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A repeated DNA element in Xenopus laevis is described that is present in about 7500 copies dispersed throughout the genome. It was first identified in the 5' flanking region of one vitellogenin gene and was therefore named the Vi element. Seven copies are present within the vitellogenin gene region, three of them within introns of the genes A1, A2 and B2, and the other four copies in the gene flanking regions. Four of these copies have been sequenced. The Vi element is bounded by a well-conserved 13 base-pair inverted repeat; in addition, it is flanked by a three base-pair direct repeat that appears to be site-specific. The length of these four copies varies from 112 to 469 base-pairs; however, sequence homology between the different copies is very high. Their structural characteristics suggest that length heterogeneity may have arisen by either unequal recombinations, deletions or tandem duplications. Altogether, the characteristics and properties of the Vi element indicate that it might represent a mobile genetic element. One of the four copies sequenced is inserted close (position -535) to the transcription initiation site of the vitellogenin gene B2 in a region otherwise showing considerable homology with the closely related gene B1. Nevertheless, the presence of the Vi element does not seem to influence significantly the estrogen-controlled expression of gene B2. In addition, three alleles of this gene created by length polymorphism in intron 3 and in the Vi element inserted near the transcription initiation site are described.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The complete mitochondrial DNA (mtDNA) control region was amplified and directly sequenced in two species of shrew, Crocidura russula and Sorex araneus (Insectivora, Mammalia). The general organization is similar to that found in other mammals: a central conserved region surrounded by two more variable domains. However, we have found in shrews the simultaneous presence of arrays of tandem repeats in potential locations where repeats tend to occur separately in other mammalian species. These locations correspond to regions which are associated with a possible interruption of the replication processes, either at the end of the three-stranded D-loop structure or toward the end of the heavy-strand replication. In the left domain the repeated sequences (R1 repeats) are 78 bp long, whereas in the right domain the repeats are 12 bp long in C. russula and 14 bp long in S. araneus (R2 repeats). Variation in the copy number of these repeated sequences results in mtDNA control region length differences. Southern blot analysis indicates that level of heteroplasmy (more than one mtDNA form within an individual) differs between species. A comparative study of the R2 repeats in 12 additional species representing three shrew subfamilies provides useful indications for the understanding of the origin and the evolution of these homologous tandemly repeated sequences. An asymmetry in the distribution of variants within the arrays, as well as the constant occurrence of shorter repeated sequences flanking only one side of the R2 arrays, could be related to asymmetry in the replication of each strand of the mtDNA molecule. The pattern of sequence and length variation within and between species, together with the capability of the arrays to form stable secondary structures, suggests that the dominant mechanism involved in the evolution of these arrays in unidirectional replication slippage.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

DNA assembly is among the most fundamental and difficult problems in bioinformatics. Near optimal assembly solutions are available for bacterial and small genomes, however assembling large and complex genomes especially the human genome using Next-Generation-Sequencing (NGS) technologies is shown to be very difficult because of the highly repetitive and complex nature of the human genome, short read lengths, uneven data coverage and tools that are not specifically built for human genomes. Moreover, many algorithms are not even scalable to human genome datasets containing hundreds of millions of short reads. The DNA assembly problem is usually divided into several subproblems including DNA data error detection and correction, contig creation, scaffolding and contigs orientation; each can be seen as a distinct research area. This thesis specifically focuses on creating contigs from the short reads and combining them with outputs from other tools in order to obtain better results. Three different assemblers including SOAPdenovo [Li09], Velvet [ZB08] and Meraculous [CHS+11] are selected for comparative purposes in this thesis. Obtained results show that this thesis’ work produces comparable results to other assemblers and combining our contigs to outputs from other tools, produces the best results outperforming all other investigated assemblers.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The low molecular weight glutenin subunits (LMW-GS) are major components of the glutenin polymers which determine the elastomeric properties of wheat (Triticum aestivum L.) gluten and dough. They comprise a complex mixture of components and have proved to be difficult to purify for detailed characterisation. The mature LMW subunit proteins comprise two structural domains, with one domain consisting of repeated sequences based on short peptide motifs. DNA sequences encoding this domain and a whole subunit were expressed in Escherichia coli and the recombinant proteins purified. Detailed comparisons by spectroscopy (CD, FT-IR) and dynamic light scattering indicated that the repetitive and non-repetitive domains of the proteins formed different structures with the former having an extended conformation with an equilibrium between poly-L-proline II-like structure and type II’ b-turns, and the latter a more compact globular structure rich in a-helix. Although the structures of these two domains appear to form independently, dynamic light scattering of the whole subunit dissolved in trifluoroethanol(TFE) suggested that they interact, leading to a more compact conformation. These observations may have relevance to the role of the LMW-GS in gluten structure and functionality.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cationic lipids-DNA complexes (lipoplexes) have been used for delivery of nucleic acids into cells in vitro and in vivo. Despite the fact that, over the last decade, significant progress in the understanding of the cellular pathways and mechanisms involved in lipoplexes-mediated gene transfection have been achieved, a convincing relationship between the structure of lipoplexes and their in vivo and in vitro transfection activity is still missing. How does DNA affect the lipid packing and what are the consequences for transfection efficiency is the point we want to address here. We investigated the bilayer organization in cationic liposomes by electron spin resonance (ESR). Phospholipids spin labeled at the 5th and 16th carbon atoms were incorporated into the DNA/diC14-amidine complex. Our data demonstrate that electrostatic interactions involved in the formation of DNA-cationic lipid complex modify the packing of the cationic lipid membrane. DNA rigidifies the amidine fluid bilayer and fluidizes the amidine rigid bilayer just below the gel-fluid transition temperature. These effects were not observed with single nucleotides and are clearly related to the repetitive charged motif present in the DNA chain and not to a charge-charge interaction. These modifications of the initial lipid packing of the cationic lipid may reorient its cellular pathway towards different routes. A better knowledge of the cationic lipid packing before and after interaction with DNA may therefore contribute to the design of lipoplexes capable to reach specific cellular targets. (c) 2009 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Trichophyton rubrum is the most common pathogen causing dermatophytosis. Molecular strain-typing methods have recently been developed to tackle epidemiological questions and the problem of relapse following treatment. A total of 67 strains of T rubrum were screened for genetic variation by randomly amplified polymorphic DNA (RAPD) analysis, with two primers, 5'-d[GGTGCGGGAA]-3' and 5'-d[CCCGTCAGCA]-3', as well as by subrepeat element analysis of the nontranscribed spacer of rDNA, using the repetitive subelements TRS-1 and TRS-2. A total of 12 individual patterns were recognized with the first primer and 11 with the second. Phylogenetic analysis of the RAPID products showed a high degree of similarity (> 90 %) among the epidemiologically related clinical isolates, while the other strains possessed 60% similarity. Specific amplification of TRS-1 produced three strain-characteristic banding patterns (PCR types); simple patterns representing one copy of TRS-1 and two copies of TRS-2 accounted for around 85 % of all isolates. It is concluded that molecular analysis has important implications for epidemiological studies, and RAPID analysis is especially suitable for molecular typing in T. rubrum.