Aperiodicity, structure, and dynamics in Ni(CN)(2)

By combining the results of both x-ray diffraction and neutron total-scattering experiments, we show that Ni(CN)(2) exhibits long-range structural order only in two dimensions, with no true periodicity perpendicular to its gridlike layers. Reverse Monte Carlo analysis gives an experimental distinction between M-C and M-N bond lengths in a homometallic cyanide framework and identifies the vibrational modes responsible for anomalous positive and negative thermal expansion in the title compound.

Water-soluble, unimolecular containers based on amphiphilic multiarm star block copolymers

A new class of water-soluble, amphiphilic star block copolymers with a large number of arms was prepared by sequential atom transfer radical polymerization (ATRP) of n-butyl methacrylate (BMA) and poly( ethylene glycol) methyl ether methacrylate (PEGMA). As the macroinitiator for the ATRP, a 2-bromoisobutyric acid functionalized fourth-generation hyperbranched polyester (Boltorn H40) was used, which allowed the preparation of star polymers that contained on average 20 diblock copolymer arms. The synthetic concept was validated by AFM experiments, which allowed direct visualization of single molecules of the multiarm star block copolymers. DSC and SAXS experiments on bulk samples suggested a microphase-separated structure, in agreement with the core-shell architecture of the polymers. SAXS experiments on aqueous solutions indicated that the star block copolymers can be regarded as unimolecular micelles composed of a PBMA core and a diffuse PPEGMA corona. The ability of the polymers to encapsulate and release hydrophobic guests was evaluated using H-1 NMR spectroscopy. In dilute aqueous solution, these polymers act as unimolecular containers that can be loaded with up to 27 wt % hydrophobic guest molecules.

Inelastic neutron scattering in spectroscopic studies of hydrogen on carbon-supported catalysts-experimental spectra and computed spectra of model systems

Inelastic neutron scattering spectroscopy has been used to observe and characterise hydrogen on the carbon component of a Pt/C catalyst. INS provides the complete vibration spectrum of coronene, regarded as a molecular model of a graphite layer. The vibrational modes are assigned with the aid of ab initio density functional theory calculations and the INS spectra by the a-CLIMAX program. A spectrum for which the H modes of coronene have been computationally suppressed, a carbon-only coronene spectrum, is a better representation of the spectrum of a graphite layer than is coronene itself. Dihydrogen dosing of a Pt/C catalyst caused amplification of the surface modes of carbon, an effect described as H riding on carbon. From the enhancement of the low energy carbon modes (100-600 cm(-1)) it is concluded that spillover hydrogen becomes attached to dangling bonds at the edges of graphitic regions of the carbon support. (C) 2003 Elsevier Science B.V. All rights reserved.

Structure, rheology and shear alignment of Pluronic block copolymer mixtures

The structure and flow behaviour of binary mixtures of Pluronic block copolymers P85 and P123 is investigated by small-angle scattering, rheometry and mobility tests. Micelle dimensions are probed by dynamic light scattering. The micelle hydrodynamic radius for the 50/50 mixture is larger than that for either P85 or P123 alone, Clue to the formation of mixed micelles with a higher association number. The phase diagram for 50/50 mixtures contains regions Of Cubic and hexagonal phases similar to those for the parent homopolymers, however the region of stability of the cubic phase is enhanced at low temperature and concentrations above 40 wt%. This is ascribed to favourable packing of the mixed micelles containing core blocks with two different chain lengths, but similar corona chain lengths. The shear flow alignment of face-centred cubic and hexagonal phases is probed by in situ small-angle X-ray or neutron scattering with simultaneous rheology. The hexagonal phase can be aligned using steady shear in a Couette geometry, however the high modulus Cubic phase cannot be aligned well in this way. This requires the application of oscillatory shear or compression. (C) 2008 Elsevier Inc. All rights reserved.

A study by high energy transfer inelastic neutron scattering spectroscopy of the mineral fraction of ox femur bone

We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Modelling small angle neutron scattering data from electrospun fibres

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relationship between phonons and thermal expansion in Zn(CN)2 and Ni(CN)2 from inelastic neutron scattering and ab initio calculations

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Extracting quantitative structural parameters for disordered polymers from neutron scattering data

The organization of non-crystalline polymeric materials at a local level, namely on a spatial scale between a few and 100 a, is still unclear in many respects. The determination of the local structure in terms of the configuration and conformation of the polymer chain and of the packing characteristics of the chain in the bulk material represents a challenging problem. Data from wide-angle diffraction experiments are very difficult to interpret due to the very large amount of information that they carry, that is the large number of correlations present in the diffraction patterns.We describe new approaches that permit a detailed analysis of the complex neutron diffraction patterns characterizing polymer melts and glasses. The coupling of different computer modelling strategies with neutron scattering data over a wide Q range allows the extraction of detailed quantitative information on the structural arrangements of the materials of interest. Proceeding from modelling routes as diverse as force field calculations, single-chain modelling and reverse Monte Carlo, we show the successes and pitfalls of each approach in describing model systems, which illustrate the need to attack the data analysis problem simultaneously from several fronts.

Extracting and validating force fields for disordered polymeric materials from neutron scattering data

We present a new approach that allows the determination and refinement of force field parameters for the description of disordered macromolecular systems from experimental neutron diffraction data obtained over a large Q range. The procedure is based on tight coupling between experimentally derived structure factors and computer modelling. By separating the potential into terms representing respectively bond stretching, angle bending and torsional rotation and by treating each of them separately, the various potential parameters are extracted directly from experiment. The procedure is illustrated on molten polytetrafluoroethylene.

Extracting force fields for disordered polymeric materials from neutron scattering data

We present a new approach that allows the determination of force-field parameters for the description of disordered macromolecular systems from experimental neutron diffraction data obtained over a large Q range. The procedure is based on a tight coupling between experimentally derived structure factors and computer modelling. We separate the molecular potential into non-interacting terms representing respectively bond stretching, angle bending and torsional rotation. The parameters for each of the potentials are extracted directly from experimental data through comparison of the experimental structure factor and those derived from atomistic level molecular models. The viability of these force fields is assessed by comparison of predicted large-scale features such as the characteristic ratio. The procedure is illustrated on molten poly(ethylene) and poly(tetrafluoroethylene).

The effect of the magnetic field of the secondary star in dwarf novae

We investigate the effect of a secondary star magnetic field on the accretion disc dynamics of dwarf novae. Simulations have been carried out with a particle code and a dipolar magnetic field structure. The magnetic field acts to remove angular momentum from the disc material, increasing the inward mass flow. This makes the accretion disc more centrally condensed, causing a reduction in the recurrence time for dwarf nova outbursts. We have produced Doppler tomograms and light curves which may be compared with observations. These tomograms are significantly different from those produced in the absence of a magnetic field on the secondary. We derive an upper limit to the magnetic moment of the secondary star in UGem of mu_2<2x10^32 A m^2. The magnetic truncation of the accretion disc produces resonance phenomena similar to those seen in the superoutbursts of SUUMa systems. While these have not been observed for systems like UGem, observations of the SUUMa systems provide us with a useful diagnostic of the disc-field interaction. We are able to place an upper limit on the magnetic moment of the secondary in ZCha of mu_2<1x10^30 A m^2.

Local and average structure in zinc cyanide: towards an understanding of the atomistic origin of negative thermal expansion

Neutron diffraction at 11.4 and 295 K and solid-state 67Zn NMR are used to determine both the local and average structures in the disordered, negative thermal expansion (NTE) material, Zn(CN)2. Solid-state NMR not only confirms that there is head-to-tail disorder of the C≡N groups present in the solid, but yields information about the relative abundances of the different Zn(CN)4-n(NC)n tetrahedral species, which do not follow a simple binomial distribution. The Zn(CN)4 and Zn(NC)4 species occur with much lower probabilities than are predicted by binomial theory, supporting the conclusion that they are of higher energy than the other local arrangements. The lowest energy arrangement is Zn(CN)2(NC)2. The use of total neutron diffraction at 11.4 K, with analysis of both the Bragg diffraction and the derived total correlation function, yields the first experimental determination of the individual Zn−N and Zn−C bond lengths as 1.969(2) and 2.030(2) Å, respectively. The very small difference in bond lengths, of ~0.06 Å, means that it is impossible to obtain these bond lengths using Bragg diffraction in isolation. Total neutron diffraction also provides information on both the average and local atomic displacements responsible for NTE in Zn(CN)2. The principal motions giving rise to NTE are shown to be those in which the carbon and nitrogen atoms within individual Zn−C≡N−Zn linkages are displaced to the same side of the Zn···Zn axis. Displacements of the carbon and nitrogen atoms to opposite sides of the Zn···Zn axis, suggested previously in X-ray studies as being responsible for NTE behavior, in fact make negligible contribution at temperatures up to 295 K.

New insights into the structure of exotic nuclei using the RISING active stopper

This conference paper outlines the operation and some of the preliminary physics results using the GSI RISING active stopper. Data are presented from an experiment using combined isomer and beta‐delayed gamma‐ray spectroscopy to study low‐lying spectral and decay properties of heavy‐neutron‐rich nuclei around A∼190 produced following the relativistic projectile fragmentation of 208Pb primary beam. The response of the RISING active stopper detector is demonstrated for both the implantation of heavy secondary fragments and in‐situ decay of beta‐particles. Beta‐delayed gamma‐ray spectroscopy following decays of the neutron‐rich nucleus 194Re is presented to demonstrate the experimental performance of the set‐up. The resulting information inferred from excited states in the W and Os daughter nuclei is compared with results from Skyrme Hartree‐Fock predictions of the evolution of nuclear shape.