Induction of immune response in broiler chickens immunized with recombinant FliC and challenged by Salmonella Typhimurium

The study examined (1) the immune response in broiler chickens after oral immunization with recombinant flagellin (rFliC) from Salmonella Typhimurium conjugated with sodium alginate microparticles, and the immune response enhancement in association with recombinant cholera toxin B subunit protein (rCTB) and pool of Lactobacillus spp. (PL). The immune responses were evaluated by dosage of IgY serum and IgA from intestinal fluid and immunostaining of CD8+ T lymphocytes in the cecum. The immunized animals were challenged with Salmonella Typhimurium (ST) 21 days after treatment. In all immunized groups, a significant increase (p<0.05) was observed in IgA levels (μg/mL), especially three weeks after immunization. The serum IgY levels (μg/mL) were little affected by the treatments and differed significantly among groups only in the second post-immunization week (p<0.05). After the challenge, the number of CD8+ T cells differed significantly between the treatments and negative control. Retrieval of Salmonella Typhimurium was not detected at 48 hours after the challenge in T2 (rFliC+rCTb), T3 (rFliC+PL) and T4 (rFliC+rCTB PL). The rFliC administered orally with or without rCTB and Lactobacillus spp. produces significant induction of humoral immune response, and the immunized chickens were more effective in eliminating Salmonella after challenge.

Cellular immune response of Curraleiro Pé-duro and Nellore calves following Mycobacterium bovis-BCG vaccination

The present study aimed to assess the CD4, CD8 and γδ blood levels for Curraleiro Pé-duro, as well as the specific IFN-γ response after BCG vaccination using flow cytometry. The specific immune response against BCG was also evaluated by tuberculin skin test, performed before and 45 days after the vaccination. For comparison purposes, the same parameters were investigated on Nellore calves, an exotic bovine with resistance previously demonstrated. Naturally, Curraleiro Pé-duro animals had greater levels of CD4, CD8 and γδ lymphocytes (p<0.05). In response to vaccine, Curraleiro Pé-duro showed greater ability to respond specifically to BCG, generating resistance profile (Th1), evidenced by greater number of antigen specific CD4+ cells producing IFN-γ (p<0.05) and also higher tuberculin skin test reaction (p<0.05). Additionally, vaccinated Curraleiro Pé-duro calves had higher CD4 cells numbers than both Nellore control (p<0.05) and vaccinated groups (p<0.05). Curraleiro Pé-duro calves' higher basal lymphocytes blood level and stronger response in both IFN-γ and tuberculin skin test parameters probably play a positive role on protection/resistance to Mycobacterium bovis.

Distribution of immune response cells in the pelvic urethra and the prepuce of rams

The pathogens of the reproductive system in the male can penetrate and establish by ascending route, from to the prepuce to the urethra, accessory glands, epididymis and testicles. The aim of this paper is determine the distribution and number of cells involved in the immune response in prepuce and pelvic urethra of rams, without apparent clinical alterations in testicle, epididymis and prepuce. The distribution of some of the cells involved in the immune response at the level of the prepuce and the pelvic urethra was quantified in four one-year-old rams seronegative for B. ovis and A. seminis and without apparent lesions in the testicles, the epididymis, and the prepuce. At the moment of slaughter, samples were taken from the preputial fornix and the pelvic urethra and placed in 10% formalin and under freezing conditions. CD4, CD8, WC1, CD45RO, CD14 and CD1b cells were demonstrated by immunohistochemistry, and immunoglobulin-containing cells (ICC) of the IgA, IgG and IgM classes were demonstrated by immunofluorescence. The labeled cells present in the mucosa of both organs were counted with an image analyzer. The total number of cells was compared between both tissues and differentially between the epithelium and the connective tissue of the mucosa. Significant differences were found in the total number of CD4, CD45RO, and WC1 lymphocytes, in CD14 macrophages, and CD1b dendritic cells, with mean values being greater in the fornix than in the urethra (p<0.05) in all cases. Only dendritic cells were found in the prepuce. No differences were found in the number of CD8 lymphocytes between both organs. The ratio between each cell type in the connective and the intraepithelial tissues and between organs was 10/1 for CD4 in the fornix (p<0.05), against 7/1 in the urethra (p<0.05), while CD8 had a 1/1 distribution in both mucosae. The WC1 ratio was 5/1 in both mucosae (p<0.05). CD45RO labeling was 19/1 in the prepuce (p<0.05) and 1/1 in the urethra. IgA-containing cells did not show differences in the total number of cells in both tissues. In the urethra, no IgG-containing cells were observed and IgM-containing cells were scarce; in contrast, both cell types were present in the prepuce, in amounts greater than in the urethra (p<0.05). IgA-, IgG-, and IgM-containing cells were located in both organs in the mucosal connective tissue. The presence of antigen-presenting cells, macrophages, and dendritic cells, as well as of lymphocytes CD4, CD8 TCR γδ (WC1), IgA-, IgG and IgM positive cells, and CD45RO cells suggests that both mucosae may behave as inductive and effector sites for the mucosal immune response.

Interleukin-15 as a potential regulator of the innate immune response

Interleukin-15 (IL-15) is a newly-discovered cytokine that is produced by activated monocytes early in the course of the innate immune response. IL-15 is able to bind to components of the interleukin-2 receptor (IL-2R) despite the fact that it has no sequence homology with IL-2. IL-15 stimulates human natural killer cell proliferation, cytotoxicity, and cytokine production and can substitute for IL-2 under most conditions. In vitro studies indicate that monocyte-derived IL-15 may be an important determinant of IFN-gamma production by NK cells. In addition, IL-15 is able to promote the survival of natural killer cells under serum-free conditions. The IL-15 receptor is a heterotrimeric complex which is composed of the IL-2Rß and g chains in combination with a unique alpha chain (IL-15a). The IL-15Ra chain has strong sequence homology to the IL-2Ra chain and confers high affinity binding to the IL-15R. In contrast to IL-2, transcript for IL-15 and IL-15a is expressed in a number of tissues and indicates that IL-15 may be an important ligand for cells that express components of the IL-2R

Characterization of the mucosal and systemic immune response induced by Cry1Ac protein from Bacillus thuringiensis HD 73 in mice

The present paper describes important features of the immune response induced by the Cry1Ac protein from Bacillus thuringiensis in mice. The kinetics of induction of serum and mucosal antibodies showed an immediate production of anti-Cry1Ac IgM and IgG antibodies in serum after the first immunization with the protoxin by either the intraperitoneal or intragastric route. The antibody fraction in serum and intestinal fluids consisted mainly of IgG1. In addition, plasma cells producing anti-Cry1Ac IgG antibodies in Peyer's patches were observed using the solid-phase enzyme-linked immunospot (ELISPOT). Cry1Ac toxin administration induced a strong immune response in serum but in the small intestinal fluids only anti-Cry1Ac IgA antibodies were detected. The data obtained in the present study confirm that the Cry1Ac protoxin is a potent immunogen able to induce a specific immune response in the mucosal tissue, which has not been observed in response to most other proteins.

Immune response induced in mice oral immunization with cowpea severe mosaic virus

There is increasing interest in the immune response induced by plant viruses since these could be used as antigen-expressing systems in vaccination procedures. Cowpea severe mosaic virus (CPSMV), as a purified preparation (300 g of leaves, 2 weeks post-inoculation), or crude extract from cowpea (Vigna unguiculata) leaves infected with CPSMV both administered by gavage to Swiss mice induced a humoral immune response. Groups of 10 Swiss mice (2-month-old females) were immunized orally with 10 daily doses of either 50 µg viral capsid protein (boosters of 50 µg at days 21 and 35 after immunization) or 0.6 mg protein of the crude extract (boosters of 0.6 mg at days 21 and 35 after immunization). Anti-CPSMV antibodies were quantified by ELISA in pooled sera diluted at least 1:400 at days 7, 14, 21, 28, 35 and 42 after the 10th dose. IgG and IgA against CPSMV were produced systemically, but IgE was not detected. No synthesis of specific antibodies against the proteins of leaf extracts from V. unguiculata, infected or not with CPSMV, was detected. The use of CPSMV, a plant-infecting virus that apparently does not induce a pathogenic response in animals, induced a humoral and persistent (at least 6 months) immune response through the administration of low antigen doses by gavage. These results raise the possibility of using CPSMV either as a vector for the production of vaccines against animal pathogens or in quick and easy methods to produce specific antisera for viral diagnosis.

Immune response to respiratory syncytial virus in young Brazilian children

We have evaluated the cellular and humoral immune response to primary respiratory syncytial virus (RSV) infection in young infants. Serum specimens from 65 patients <=12 months of age (39 males and 26 females, 28 cases <3 months and 37 cases > or = 3 months; median 3 ± 3.9 months) were tested for anti-RSV IgG and IgG subclass antibodies by EIA. Flow cytometry was used to characterize cell surface markers expressed on peripheral blood mononuclear cells (PBMC) from 29 RSV-infected children. There was a low rate of seroconversion in children <3 months of age, whose acute-phase PBMC were mostly T lymphocytes (63.0 ± 9.0%). In contrast, a higher rate of seroconversion was observed in children >3 months of age, with predominance of B lymphocytes (71.0 ± 17.7%). Stimulation of PBMC with RSV (2 x 10(5) TCID50) for 48 h did not induce a detectable increase in intracellular cytokines and only a few showed a detectable increase in RSV-specific secreted cytokines. These data suggest that age is an important factor affecting the infants' ability to develop an immune response to RSV.

Effect of surgical treatment on the cellular immune response of gastric cancer patients

Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.

Impairment of cytomegalovirus-specific cellular immune response as a risk factor for cytomegalovirus disease in transplant recipients

Human cytomegalovirus (CMV) infection is common in most people but nearly asymptomatic in immunocompetent individuals. After primary infection the virus persists throughout life in a latent form in a variety of tissues, particularly in precursor cells of the monocytic lineage. CMV reinfection and occurrence of disease are associated with immunosuppressive conditions. Solid organ and bone marrow transplant patients are at high risk for CMV disease as they undergo immunosuppression. Antiviral treatment is effective in controlling viremia, but 10-15% of infected patients can experience CMV disease by the time the drug is withdrawn. In addition, long-term antiviral treatment leads to bone marrow ablation and renal toxicity. Furthermore, control of chronic CMV infection in transplant recipients appears to be dependent on the proper recovery of cellular immunity. Recent advances in the characterization of T-cell functions and identification of distinct functional signatures of T-cell viral responses have opened new perspectives for monitoring transplant individuals at risk of developing CMV disease.

Recombinant E2 glycoprotein of bovine viral diarrhea virus induces a solid humoral neutralizing immune response but fails to confer total protection in cattle

Two recombinant baculoviruses were produced in order to obtain a bovine viral diarrhea virus (BVDV) immunogen: AcNPV/E2 expressing E2 glycoprotein, and AcNPV/E0E1E2 expressing the polyprotein region coding for the three structural proteins of BVDV (E0, E1, and E2). Mice were immunized with Sf9 cells infected with the recombinant baculoviruses in a water in oil formulation and the production of neutralizing antibodies was evaluated. Since E2 elicited higher neutralizing antibody titers than E0-E1-E2 polyprotein, it was selected to immunize cattle. Calves received two doses of recombinant E2 vaccine and were challenged with homologous BVDV 37 days later. The recombinant immunogen induced neutralizing titers which showed a mean value of 1.5 ± 0.27 on the day of challenge and reached a top value of 3.36 ± 0.36, 47 days later (84 days post-vaccination). On the other hand, sera from animals which received mock-infected Sf9 cells did not show neutralizing activity until 25 days post-challenge (62 days post-vaccination), suggesting that these antibodies were produced as a consequence of BVDV challenge. Even when no total protection was observed in cattle, in vitro viral neutralization assays revealed that the recombinant immunogen was able to induce neutralizing antibody synthesis against the homologous strain as well as against heterologous strains in a very efficient way.

Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund’s incomplete adjuvant on the immune response of cattle

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Role of CD4+ T cells in the regulation of the immune response against encapsulated Group B Streptococcus

Le Streptocoque de groupe B (GBS) est un important agent d’infection invasive pouvant mener à la mort et demeure la cause principale de septicémie néonatale à ce jour. Neuf sérotypes ont été officiellement décrits basés sur la composition de la capsule polysaccharidique (CPS). Parmi ces sérotypes, le type III est considéré le plus virulent et fréquemment associé aux maladies invasives graves, telle que la méningite. Malgré que plusieurs recherches aient été effectuées au niveau des interactions entre GBS type III et les cellules du système immunitaire innées, aucune information n’est disponible sur la régulation de la réponse immunitaire adaptative dirigée contre ce dernier. Notamment, le rôle de cellules T CD4+ dans l’immuno-pathogenèse de l’infection causée par GBS n’a jamais été étudié. Dans cet étude, trois différents modèles murins d’infection ont été développé pour évaluer l’activation et la modulation des cellules T CD4+ répondantes au GBS de type III : ex vivo, in vivo, et in vitro. Les résultats d’infections ex vivo démontrent que les splénocytes totaux répondent à l’infection en produisant des cytokines de type-1 pro-inflammatoires. Une forte production d’IL-10 accompagne cette cascade inflammatoire, probablement dans l’effort de l’hôte de maintenir l’homéostasie. Les résultats démontrent aussi que les cellules T sont activement recrutées par les cellules répondantes du système inné en produisant des facteurs chimiotactiques, tels que CXCL9, CXCL10, et CCL3. Plus spécifiquement, les résultats obtenus à partir des cellules isolées T CD4+ provenant des infections ex vivo ou in vivo démontrent que ces cellules participent à la production d’IFN-γ et de TNF-α ainsi que d’IL-2, suggérant un profil d’activation Th1. Les cellules isolées T CD4+ n’étaient pas des contributeurs majeurs d’IL-10. Ceci indique que cette cytokine immuno-régulatrice est principalement produite par les cellules de l’immunité innée de la rate de souris infectées. Le profil Th1 des cellules T CD4+ a été confirmé en utilisant un modèle in vitro. Nos résultats démontrent aussi que la CPS de GBS a une role immuno-modulateur dans le développement de la réponse Th1. En résumé, cette étude adresse pour la première fois, la contribution des cellules T CD4+ dans la production d’IFN-γ lors d’une infection à GBS et donc, dans le développement d’une réponse de type Th1. Ces résultats renforcent d’avantage le rôle central de cette cytokine pour un control efficace des infections causées par ce pathogène.

Recognition of hepatitis C virus RNA by toll like receptors 7 and 8 : implications for the initiation of innate immune response

Le virus de l’hépatite C (VHC) est un virus à ARN simple brin positif (ssARN) qui se replique dans le foie. Deux cents millions de personnes sont infectées par le virus dans le monde et environ 80% d’entre elles progresseront vers un stade chronique de l’infection. Les thérapies anti-virales actuelles comme l’interféron (IFN) ou la ribavirin sont de plus en plus utilisées mais ne sont efficaces que dans la moitié des individus traités et sont souvent accompagnées d’une toxicité ou d’effets secondaires indésirables. Le système immunitaire inné est essentiel au contrôle des infections virales. Les réponses immunitaires innées sont activées suite à la reconnaissance par les Pathogen Recognition Receptors (PRRs), de motifs macromoléculaires dérivés du virus appelés Pathogen-Associated Molecular Patterns (PAMPs). Bien que l'activation du système immunitaire par l'ARN ou les protéines du VHC ait été largement étudiée, très peu de choses sont actuellement connues concernant la détection du virus par le système immunitaire inné. Et même si l’on peut très rapidement déceler des réponses immunes in vivo après infection par le VHC, l’augmentation progressive et continue de la charge virale met en évidence une incapacité du système immunitaire à contrôler l’infection virale. Une meilleure compréhension des mécanismes d’activation du système immunitaire par le VHC semble, par conséquent, essentielle au développement de stratégies antivirales plus efficaces. Dans le présent travail nous montrons, dans un modèle de cellule primaire, que le génome ARN du VHC contient des séquences riches en GU capables de stimuler spécifiquement les récepteurs de type Toll (TLR) 7 et 8. Cette stimulation a pour conséquence la maturation des cellules dendritiques plasmacytoïdes (pDCs), le production d’interféron de type I (IFN) ainsi que l’induction de chémokines et cytokines inflammatoires par les différentes types de cellules présentatrices d’antigènes (APCs). Les cytokines produites après stimulation de monocytes ou de pDCs par ces séquences ssARN virales, inhibent la production du virus de façon dépendante de l’IFN. En revanche, les cytokines produites après stimulation de cellules dendritiques myéloïdes (mDCs) ou de macrophages par ces mêmes séquences n’ont pas d’effet inhibiteur sur la production virale car les séquences ssARN virales n’induisent pas la production d’IFN par ces cellules. Les cytokines produites après stimulation des TLR 7/8 ont également pour effet de diminuer, de façon indépendante de l’IFN, l’expression du récepteur au VHC (CD81) sur la lignée cellulaire Huh7.5, ce qui pourrait avoir pour conséquence de restreindre l’infection par le VHC. Quoiqu’il en soit, même si les récepteurs au VHC comme le CD81 sont largement exprimés à la surface de différentes sous populations lymphocytaires, les DCs et les monocytes ne répondent pas aux VHC, Nos résultats indiquent que seuls les macrophages sont capables de reconnaître le VHC et de produire des cytokines inflammatoires en réponse à ce dernier. La reconnaissance du VHC par les macrophages est liée à l’expression membranaire de DC-SIGN et l’engagement des TLR 7/8 qui en résulte. Comme d’autres agonistes du TLR 7/8, le VHC stimule la production de cytokines inflammatoires (TNF-α, IL-8, IL-6 et IL-1b) mais n’induit pas la production d’interféron-beta par les macrophages. De manière attendue, la production de cytokines par des macrophages stimulés par les ligands du TLR 7/8 ou les séquences ssARN virales n’inhibent pas la réplication virale. Nos résultats mettent en évidence la capacité des séquences ssARN dérivées du VHC à stimuler les TLR 7/8 dans différentes populations de DC et à initier une réponse immunitaire innée qui aboutit à la suppression de la réplication virale de façon dépendante de l’IFN. Quoiqu’il en soit, le VHC est capable d’échapper à sa reconnaissance par les monocytes et les DCs qui ont le potentiel pour produire de l’IFN et inhiber la réplication virale après engagement des TLR 7/8. Les macrophages possèdent quant à eux la capacité de reconnaître le VHC grâce en partie à l’expression de DC-SIGN à leur surface, mais n’inhibent pas la réplication du virus car ils ne produisent pas d’IFN. L’échappement du VHC aux défenses antivirales pourrait ainsi expliquer l’échec du système immunitaire inné à contrôler l’infection par le VHC. De plus, la production de cytokines inflammatoires observée après stimulation in vitro des macrophages par le VHC suggère leur potentielle contribution dans l’inflammation que l’on retrouve chez les individus infectés par le VHC.