991 resultados para MOTILITY-STIMULATING PROTEIN
Resumo:
We used a bacterially expressed fusion protein containing the entire cytoplasmic domain of the human leukemia inhibitory factor (LIF) receptor to study its phosphorylation in response to LIF stimulation. The dose- and time-dependent relationships for phosphorylation of this construct in extracts of LIF-stimulated 3T3-L1 cells were superimposable with those for the stimulation of mitogen-activated protein kinase (MAPK). Indeed, phosphorylation of the cytoplasmic domain of the low-affinity LIF receptor alpha-subunit (LIFR) in Mono Q-fractionated, LIF-stimulated 3T3-L1 extracts occurred only in those fractions containing activated MAPK; Ser-1044 served as the major phosphorylation site in the human LIFR for MAPK both in agonist-stimulated 3T3-L1 lysates and by recombinant extracellular signal-regulated kinase 2 in vitro. Expression in rat H-35 hepatoma cells of LIFR or chimeric granulocyte-colony-stimulating factor receptor (G-CSFR)-LIFR mutants lacking Ser-1044 failed to affect cytokine-stimulated expression of a reporter gene under the control of the beta-fibrinogen gene promoter but eliminated the insulin-induced attenuation of cytokine-stimulated gene expression. Thus, our results identify the human LIFR as a substrate for MAPK and suggest a mechanism of heterologous receptor regulation of LIFR signaling occurring at Ser-1044.
Resumo:
Extracellular human immunodeficiency virus type 1 (HIV-1) Tat protein promotes growth of spindle cells derived from AIDS-associated Kaposi sarcoma (AIDS-KS), an angioproliferative disease very frequent in HIV-1-infected individuals. Normal vascular cells, progenitors of AIDS-KS cells, proliferate in response to Tat after exposure to inflammatory cytokines, whose levels are augmented in HIV-1-infected individuals and in KS lesions. Here we show that Tat also promotes AIDS-KS and normal vascular cells to migrate and to degrade the basement membrane and stimulates endothelial cell morphogenesis on a matrix substrate. These effects are obtained at picomolar concentrations of exogenous Tat and are promoted by the treatment of the cells with the same inflammatory cytokines stimulating expression of the receptors for Tat, the integrins alpha 5 beta 1 and alpha v beta 3. Thus, under specific circumstances, Tat has angiogenic properties. As Tat and its receptors are present in AIDS-KS lesions, these data may explain some of the mechanisms by which Tat can induce angiogenesis and cooperate in the development of AIDS-KS.
Resumo:
The E6 protein of the high-risk human papillomaviruses inactivates the tumor suppressor protein p53 by stimulating its ubiquitinylation and subsequent degradation. Ubiquitinylation is a multistep process involving a ubiquitin-activating enzyme, one of many distinct ubiquitin-conjugating enzymes, and in certain cases, a ubiquitin ligase. In human papillomavirus-infected cells, E6 and the E6-associated protein are thought to act as a ubiquitin-protein ligase in the ubiquitinylation of p53. Here we describe the cloning of a human ubiquitin-conjugating enzyme that specifically ubiquitinylates E6-associated protein. Furthermore, we define the biochemical pathway of p53 ubiquitinylation and demonstrate that in vivo inhibition of various components in the pathway leads to an inhibition of E6-stimulated p53 degradation.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
La vaccination est largement utilisée pour la génération de lymphocytes T spécifiques contre les tumeurs. Malheureusement, cette stratégie n'est pas adaptée aux personnes âgées car leur thymus régresse avec l'âge conduisant ainsi à une baisse dans la production de cellules T et à l'accumulation de cellules immunitaires âgées ayant des défauts liés à leurs stimulations. Comme il a été démontré auparavant que L’IL-21 est capable d’induire des fonctions thymiques, nous avons émis l’hypothèse que l’injection d’IL-21 à des souris âgées stimulera la thymopoïèse. Nos résultats montrent que l’administration de l’IL-21 augmente le nombre absolu de thymocytes chez les souris âgées et augmente la migration de ces cellules vers la périphérie ou ils contribuent à la diversité du TCR. De plus les cellules T en périphérie expriment un niveau plus élevé de miR181-a, et par conséquent moins de phosphatase comme SHP2, DUSP5/6 qui inhibent le TCR. En vaccinant des souris âgées avec le peptide Trp2, les souris traitées avec l’IL-21 montrent un retard dans la croissance des cellules B16 tumorales. Cette étude montre que l’IL-21 pourrait être utilisé comme stratégie pour le rétablissement du systeme immunitaire chez les personnes âgées.
Resumo:
Caveolins are a crucial component of caveolae but have also been localized to the Golgi complex, and, under some experimental conditions, to lipid bodies (LBs). The physiological relevance and dynamics of LB association remain unclear. We now show that endogenous caveolin-1 and caveolin-2 redistribute to LBs in lipid loaded A431 and FRT cells. Association with LBs is regulated and reversible; removal of fatty acids causes caveolin to rapidly leave the lipid body. We also show by subcellular fractionation, light and electron microscopy that during the first hours of liver regeneration, caveolins show a dramatic redistribution from the cell surface to the newly formed LBs. At later stages of the regeneration process (when LBs are still abundant), the levels of caveolins in LBs decrease dramatically. As a model system to study association of caveolins with LBs we have used brefeldin A (BFA). BFA causes rapid redistribution of endogenous caveolins to LBs and this association was reversed upon BFA washout. Finally, we have used a dominant negative LB-associated caveolin mutant (cav(DGV)) to study LB formation and to examine its effect on LB function. We now show that the cav(DGV) mutant inhibits microtubule-dependent LB motility and blocks the reversal of lipid accumulation in LBs.
Resumo:
Three mutants with Tn5-B21 insertion in tonB3 (PA0406) of Pseudomonas aeruginosa exhibited defective twitching motility and reduced assembly of extracellular pili. These defects could be complemented with wild-type tonB3.
Resumo:
Virulence of the opportunistic pathogen Pseudomonas aeruginosa involves the coordinate expression of a wide range of virulence factors including type IV pili which are required for colonization of host tissues and are associated with a form of surface translocation termed twitching motility. Twitching motility in P. aeruginosa is controlled by a complex signal transduction pathway which shares many modules in common with chemosensory systems controlling flagella rotation in bacteria and which is composed, in part, of the previously described proteins PilG, PilH, PilI, PilJ and PilK. Here we describe another three components of this pathway: ChpA, ChpB and ChpC, as well as two downstream genes, ChpD and ChpE, which may also be involved. The central component of the pathway, ChpA, possesses nine potential sites of phosphorylation: six histidine-containing phosphotransfer (HPt) domains, two novel serine- and threonine-containing phosphotransfer (SPt, TPt) domains and a CheY-like receiver domain at its C-terminus, and as such represents one of the most complex signalling proteins yet described in nature. We show that the Chp chemosensory system controls twitching motility and type IV pili biogenesis through control of pili assembly and/or retraction as well as expression of the pilin subunit gene pilA. The Chp system is also required for full virulence in a mouse model of acute pneumonia.
Resumo:
Expression of the mouse transcription factor EC (Tfec) is restricted to the myeloid compartment, suggesting a function for Tfec in the development or function of these cells. However, mice lacking Tfec develop normally, indicating a redundant role for Tfec in myeloid cell development. We now report that Tfec is specifically induced in bone marrow-derived macrophages upon stimulation with the Th2 cytokines, IL-4 and IL-13, or LPS. LPS induced a rapid and transient up-regulation of Tfec mRNA expression and promoter activity, which was dependent on a functional NF-kappa B site. IL-4, however, induced a rapid, but long-lasting, increase in Tfec mRNA, which, in contrast to LPS stimulation, also resulted in detectable levels of Tfec protein. IL-4-induced transcription of Tfec was absent in macrophages lacking Stat6, and its promoter depended on two functional Stat6-binding sites. A global comparison of IL-4-induced genes in both wild-type and Tfec mutant macrophages revealed a surprisingly mild phenotype with only a few genes affected by Tfec deficiency. These included the G-CSFR (Csf3r) gene that was strongly up-regulated by IL-4 in wild-type macrophages and, to a lesser extent, in Tfec mutant macrophages. Our study also provides a general definition of the transcriptome in alternatively activated mouse macrophages and identifies a large number of novel genes characterizing this cell type.
Resumo:
Neutrophilic lung inflammation is an essential component of host defense against diverse eukaryotic and prokaryotic pathogens, but in chronic inflammatory lung diseases, such as chronic obstructive lung disease (COPD), severe asthma, cystic fibrosis, and bronchiolitis, it may damage the host. Glucocorticosteroids are widely used in these conditions and in their infectious exacerbations; however, the clinical efficacy of steroids is disputed. In this study, we used a proteomic approach to identify molecules contributing to neutrophilic inflammation induced by transnasal administration of lipopolysaccharide (LPS) that were also resistant to the potent glucocorticosteroid dexamethasone (Dex). We confirmed that Dex was biologically active at both the transcript (suppression of GM-CSF and TNFalpha transcripts) and protein levels (induction of lipocortin) and used 2D-PAGE/MALDI-TOF to generate global expression profiles, identifying six LPS-induced proteins that were Dex resistant. Of these, S100A8, a candidate neutrophil chemotactic factor, was profiled in detail. Steroid refractory S100A8 expression was highly abundant, transcriptionally regulated, secreted into lung lavage fluid and immunohistochemically localized to tissue infiltrating neutrophils. However, in marked contrast to other vascular beds, neutralizing antibodies to S100A8 had only a weak anti-neutrophil recruitment effect and antibodies against the related S100A9 were ineffective. These data highlight the need for extensive in vivo profiling of proteomically identified candidate molecules and demonstrates that S100A8, despite its abundance, resistance to steroids and known chemotactic activity, is unlikely to be an important determinant of LPS-induced neutrophilic lung inflammation in vivo.
Resumo:
To date, a role for agouti signalling protein (ASIP) in human pigmentation has not been well characterized. It is known that agouti plays a pivotal role in the pigment switch from the dark eumelanin to the light pheomelanin in the mouse. However, because humans do not have an agouti banded hair pattern, its role in human pigmentation has been questioned. We previously identified a single polymorphism in the 3'-untranslated region (UTR) of ASIP that was found at a higher frequency in African-Americans compared with other population groups. To compare allele frequencies between European-Australians and indigenous Australians, the g.8818A -> G polymorphism was genotyped. Significant differences were seen in allele frequencies between these groups (P < 0.0001) with carriage of the G allele highest in Australian Aborigines. In the Caucasian sample set a strong association was observed between the G allele and dark hair colour (P = 0.004) (odds ratio 4.6; 95% CI 1.4-15.27). The functional consequences of this polymorphism are not known but it was postulated that it might result in message instability and premature degradation of the transcript. To test this hypothesis, ASIP mRNA levels were quantified in melanocytes carrying the variant and non-variant alleles. Using quantitative real-time polymerase chain reaction the mean ASIP mRNA ratio of the AA genotype to the AG genotype was 12 (P < 0.05). This study suggests that the 3'-UTR polymorphism results in decreased levels of ASIP and therefore less pheomelanin production.
Resumo:
Functional interaction between bacterial surface-displayed autoaggregation proteins such as antigen 43 (Ag43) of Escherichia coli and motility organelles such as flagella has not previously been described. Here, it has been demonstrated for the first time that Ag43-mediated aggregation can inhibit bacterial motility. Ag43 overexpression produces a dominant aggregation phenotype that overrides motility in the presence of low levels of flagella. In contrast, induction of an increased flagellation state prevents Ag43-mediated aggregation. This phenomenon was observed in naturally occurring subpopulations of E coli as phase variants expressing and not expressing Ag43 revealed contrasting motility phenotypes. The effects were shown to be part of a general mechanism because other short adhesins capable of mediating autoaggregation (AIDA-I and TibA) also impaired motility. These novel insights into the function of bacterial autoaggregation proteins suggest that a balance between these two systems, i.e. autoaggregation and flagellation, influences motility.
Resumo:
To determine if low dietary protein concentration in the first two trimesters of pregnancy alters placental development, genetically similar heifers from closed herd were fed diets containing different levels of protein in the first and second trimesters of gestation. There were four animals per treatment group, the groups being: L/L = fed a diet containing 7% crude protein (CP) (low protein) in the first and second trimesters; H/H = fed a diet containing 14% (P thigh protein) in the first and second trimesters; L/H = fed low protein in the first trimester and high in the second trimester and vice versa for the H/L group. Low protein diets in the first trimester increased dry cotyledon weight at term. Trophectoderm volume density increased in the H/L and L/H group compared to the L/L and H/H groups. Blood vessel volume and volume density in foetal villi decreased in the H/L and L/H groups compared with the H/H and L/L groups. There was no effect of diet treatment on cotyledon number, diameter or wet weight and no effect on the volume density of connective tissue or fibroblasts in the foetal villi. These results show that a low dietary protein concentration in the first trimester of pregnancy followed by increased protein in the second trimester enhanced placental development. Further, trophectoderm volume was highly correlated with birth weight. Early protein restriction in the pregnant cow may enhance foetal growth in part by stimulating placental growth and function. (C) 1999 Published by Elsevier Science B.V. All rights reserved.
Resumo:
Increasing evidence suggests that tissue transglutaminase (tTGase; type II) is externalized from cells, where it may play a key role in cell attachment and spreading and in the stabilization of the extracellular matrix (ECM) through protein cross-linking. However, the relationship between these different functions and the enzyme's mechanism of secretion is not fully understood. We have investigated the role of tTGase in cell migration using two stably transfected fibroblast cell lines in which expression of tTGase in its active and inactive (C277S mutant) states is inducible through the tetracycline-regulated system. Cells overexpressing both forms of tTGase showed increased cell attachment and decreased cell migration on fibronectin. Both forms of the enzyme could be detected on the cell surface, but only the clone overexpressing catalytically active tTGase deposited the enzyme into the ECM and cell growth medium. Cells overexpressing the inactive form of tTGase did not deposit the enzyme into the ECM or secrete it into the cell culture medium. Similar results were obtained when cells were transfected with tTGase mutated at Tyr(274) (Y274A), the proposed site for the cis,trans peptide bond, suggesting that tTGase activity and/or its tertiary conformation dependent on this bond may be essential for its externalization mechanism. These results indicate that tTGase regulates cell motility as a novel cell-surface adhesion protein rather than as a matrix-cross-linking enzyme. They also provide further important insights into the mechanism of externalization of the enzyme into the extracellular matrix.
Resumo:
Background and Purpose The glucagon-like peptide 1 (GLP-1) receptor performs an important role in glycaemic control, stimulating the release of insulin. It is an attractive target for treating type 2 diabetes. Recently, several reports of adverse side effects following prolonged use of GLP-1 receptor therapies have emerged: most likely due to an incomplete understanding of signalling complexities. Experimental Approach We describe the expression of the GLP-1 receptor in a panel of modified yeast strains that couple receptor activation to cell growth via single Gα/yeast chimeras. This assay enables the study of individual ligand-receptor G protein coupling preferences and the quantification of the effect of GLP-1 receptor ligands on G protein selectivity. Key Results The GLP-1 receptor functionally coupled to the chimeras representing the human Gαs, Gαi and Gαq subunits. Calculation of the dissociation constant for a receptor antagonist, exendin-3 revealed no significant difference between the two systems. We obtained previously unobserved differences in G protein signalling bias for clinically relevant therapeutic agents, liraglutide and exenatide; the latter displaying significant bias for the Gαi pathway. We extended the use of the system to investigate small-molecule allosteric compounds and the closely related glucagon receptor. Conclusions and Implications These results provide a better understanding of the molecular events involved in GLP-1 receptor pleiotropic signalling and establish the yeast platform as a robust tool to screen for more selective, efficacious compounds acting at this important class of receptors in the future. © 2014 The Authors. British Journal of Pharmacology published by John Wiley & Sons Ltd on behalf of The British Pharmacological Society.