975 resultados para IMMUNE-RESPONSE


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Human cytomegalovirus (CMV) infection is common in most people but nearly asymptomatic in immunocompetent individuals. After primary infection the virus persists throughout life in a latent form in a variety of tissues, particularly in precursor cells of the monocytic lineage. CMV reinfection and occurrence of disease are associated with immunosuppressive conditions. Solid organ and bone marrow transplant patients are at high risk for CMV disease as they undergo immunosuppression. Antiviral treatment is effective in controlling viremia, but 10-15% of infected patients can experience CMV disease by the time the drug is withdrawn. In addition, long-term antiviral treatment leads to bone marrow ablation and renal toxicity. Furthermore, control of chronic CMV infection in transplant recipients appears to be dependent on the proper recovery of cellular immunity. Recent advances in the characterization of T-cell functions and identification of distinct functional signatures of T-cell viral responses have opened new perspectives for monitoring transplant individuals at risk of developing CMV disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two recombinant baculoviruses were produced in order to obtain a bovine viral diarrhea virus (BVDV) immunogen: AcNPV/E2 expressing E2 glycoprotein, and AcNPV/E0E1E2 expressing the polyprotein region coding for the three structural proteins of BVDV (E0, E1, and E2). Mice were immunized with Sf9 cells infected with the recombinant baculoviruses in a water in oil formulation and the production of neutralizing antibodies was evaluated. Since E2 elicited higher neutralizing antibody titers than E0-E1-E2 polyprotein, it was selected to immunize cattle. Calves received two doses of recombinant E2 vaccine and were challenged with homologous BVDV 37 days later. The recombinant immunogen induced neutralizing titers which showed a mean value of 1.5 ± 0.27 on the day of challenge and reached a top value of 3.36 ± 0.36, 47 days later (84 days post-vaccination). On the other hand, sera from animals which received mock-infected Sf9 cells did not show neutralizing activity until 25 days post-challenge (62 days post-vaccination), suggesting that these antibodies were produced as a consequence of BVDV challenge. Even when no total protection was observed in cattle, in vitro viral neutralization assays revealed that the recombinant immunogen was able to induce neutralizing antibody synthesis against the homologous strain as well as against heterologous strains in a very efficient way.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Le Streptocoque de groupe B (GBS) est un important agent d’infection invasive pouvant mener à la mort et demeure la cause principale de septicémie néonatale à ce jour. Neuf sérotypes ont été officiellement décrits basés sur la composition de la capsule polysaccharidique (CPS). Parmi ces sérotypes, le type III est considéré le plus virulent et fréquemment associé aux maladies invasives graves, telle que la méningite. Malgré que plusieurs recherches aient été effectuées au niveau des interactions entre GBS type III et les cellules du système immunitaire innées, aucune information n’est disponible sur la régulation de la réponse immunitaire adaptative dirigée contre ce dernier. Notamment, le rôle de cellules T CD4+ dans l’immuno-pathogenèse de l’infection causée par GBS n’a jamais été étudié. Dans cet étude, trois différents modèles murins d’infection ont été développé pour évaluer l’activation et la modulation des cellules T CD4+ répondantes au GBS de type III : ex vivo, in vivo, et in vitro. Les résultats d’infections ex vivo démontrent que les splénocytes totaux répondent à l’infection en produisant des cytokines de type-1 pro-inflammatoires. Une forte production d’IL-10 accompagne cette cascade inflammatoire, probablement dans l’effort de l’hôte de maintenir l’homéostasie. Les résultats démontrent aussi que les cellules T sont activement recrutées par les cellules répondantes du système inné en produisant des facteurs chimiotactiques, tels que CXCL9, CXCL10, et CCL3. Plus spécifiquement, les résultats obtenus à partir des cellules isolées T CD4+ provenant des infections ex vivo ou in vivo démontrent que ces cellules participent à la production d’IFN-γ et de TNF-α ainsi que d’IL-2, suggérant un profil d’activation Th1. Les cellules isolées T CD4+ n’étaient pas des contributeurs majeurs d’IL-10. Ceci indique que cette cytokine immuno-régulatrice est principalement produite par les cellules de l’immunité innée de la rate de souris infectées. Le profil Th1 des cellules T CD4+ a été confirmé en utilisant un modèle in vitro. Nos résultats démontrent aussi que la CPS de GBS a une role immuno-modulateur dans le développement de la réponse Th1. En résumé, cette étude adresse pour la première fois, la contribution des cellules T CD4+ dans la production d’IFN-γ lors d’une infection à GBS et donc, dans le développement d’une réponse de type Th1. Ces résultats renforcent d’avantage le rôle central de cette cytokine pour un control efficace des infections causées par ce pathogène.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Le virus de l’hépatite C (VHC) est un virus à ARN simple brin positif (ssARN) qui se replique dans le foie. Deux cents millions de personnes sont infectées par le virus dans le monde et environ 80% d’entre elles progresseront vers un stade chronique de l’infection. Les thérapies anti-virales actuelles comme l’interféron (IFN) ou la ribavirin sont de plus en plus utilisées mais ne sont efficaces que dans la moitié des individus traités et sont souvent accompagnées d’une toxicité ou d’effets secondaires indésirables. Le système immunitaire inné est essentiel au contrôle des infections virales. Les réponses immunitaires innées sont activées suite à la reconnaissance par les Pathogen Recognition Receptors (PRRs), de motifs macromoléculaires dérivés du virus appelés Pathogen-Associated Molecular Patterns (PAMPs). Bien que l'activation du système immunitaire par l'ARN ou les protéines du VHC ait été largement étudiée, très peu de choses sont actuellement connues concernant la détection du virus par le système immunitaire inné. Et même si l’on peut très rapidement déceler des réponses immunes in vivo après infection par le VHC, l’augmentation progressive et continue de la charge virale met en évidence une incapacité du système immunitaire à contrôler l’infection virale. Une meilleure compréhension des mécanismes d’activation du système immunitaire par le VHC semble, par conséquent, essentielle au développement de stratégies antivirales plus efficaces. Dans le présent travail nous montrons, dans un modèle de cellule primaire, que le génome ARN du VHC contient des séquences riches en GU capables de stimuler spécifiquement les récepteurs de type Toll (TLR) 7 et 8. Cette stimulation a pour conséquence la maturation des cellules dendritiques plasmacytoïdes (pDCs), le production d’interféron de type I (IFN) ainsi que l’induction de chémokines et cytokines inflammatoires par les différentes types de cellules présentatrices d’antigènes (APCs). Les cytokines produites après stimulation de monocytes ou de pDCs par ces séquences ssARN virales, inhibent la production du virus de façon dépendante de l’IFN. En revanche, les cytokines produites après stimulation de cellules dendritiques myéloïdes (mDCs) ou de macrophages par ces mêmes séquences n’ont pas d’effet inhibiteur sur la production virale car les séquences ssARN virales n’induisent pas la production d’IFN par ces cellules. Les cytokines produites après stimulation des TLR 7/8 ont également pour effet de diminuer, de façon indépendante de l’IFN, l’expression du récepteur au VHC (CD81) sur la lignée cellulaire Huh7.5, ce qui pourrait avoir pour conséquence de restreindre l’infection par le VHC. Quoiqu’il en soit, même si les récepteurs au VHC comme le CD81 sont largement exprimés à la surface de différentes sous populations lymphocytaires, les DCs et les monocytes ne répondent pas aux VHC, Nos résultats indiquent que seuls les macrophages sont capables de reconnaître le VHC et de produire des cytokines inflammatoires en réponse à ce dernier. La reconnaissance du VHC par les macrophages est liée à l’expression membranaire de DC-SIGN et l’engagement des TLR 7/8 qui en résulte. Comme d’autres agonistes du TLR 7/8, le VHC stimule la production de cytokines inflammatoires (TNF-α, IL-8, IL-6 et IL-1b) mais n’induit pas la production d’interféron-beta par les macrophages. De manière attendue, la production de cytokines par des macrophages stimulés par les ligands du TLR 7/8 ou les séquences ssARN virales n’inhibent pas la réplication virale. Nos résultats mettent en évidence la capacité des séquences ssARN dérivées du VHC à stimuler les TLR 7/8 dans différentes populations de DC et à initier une réponse immunitaire innée qui aboutit à la suppression de la réplication virale de façon dépendante de l’IFN. Quoiqu’il en soit, le VHC est capable d’échapper à sa reconnaissance par les monocytes et les DCs qui ont le potentiel pour produire de l’IFN et inhiber la réplication virale après engagement des TLR 7/8. Les macrophages possèdent quant à eux la capacité de reconnaître le VHC grâce en partie à l’expression de DC-SIGN à leur surface, mais n’inhibent pas la réplication du virus car ils ne produisent pas d’IFN. L’échappement du VHC aux défenses antivirales pourrait ainsi expliquer l’échec du système immunitaire inné à contrôler l’infection par le VHC. De plus, la production de cytokines inflammatoires observée après stimulation in vitro des macrophages par le VHC suggère leur potentielle contribution dans l’inflammation que l’on retrouve chez les individus infectés par le VHC.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cereal commodities are frequently contaminated with mycotoxins produced by the secondary metabolism of fungal infection. Among these contaminants, deoxynivalenol (DON), also known as vomitoxin, is the most prevalent type B trichothecene mycotoxin worldwide. Pigs are very sensitive to the toxic effects of DON and are frequently exposed to naturally contaminated feed. Recently, DON naturally contaminated feed has been shown to decrease porcine reproductive and respiratory syndrome virus (PRRSV) specific antibody responses following experimental infection. The objective of this study was to determine the impact of DON naturally contaminated feed on the immune response generated following vaccination with PRRSV live attenuated vaccine. Eighteen pigs were randomly divided into three experimental groups of 6 animals based on DON content of the diets (0, 2.5 and 3.5 mg DON/kg). They were fed these rations one week prior to the vaccination and for all the duration of the immune response evaluation. All pigs were vaccinated intra-muscularly with one dose of Ingelvac® PRRSV modified live vaccine (MLV). Blood samples were collected at day −1, 6, 13, 20, 27 and 35 post vaccination (pv) and tested for PRRSV RNA by RT-qPCR and for virus specific antibodies by ELISA. Results showed that ingestion of DON-contaminated diets significantly decreased PRRSV viremia. All pigs fed control diet were viremic while only 1 (17%) and 3 (50%) out of 6 pigs were viremic in the groups receiving 3.5 and 2.5 mg of DON/kg, respectively. Subsequently, all pigs fed control diet developed PRRSV specific antibodies while only viremic pigs that were fed contaminated diets have developed PRRSV specific antibodies. These results suggest that feeding pigs with DON-contaminated diet could inhibit vaccination efficiency of PRRSV MLV by severely impairing viral replication.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

National Centre for Aquatic Animal Health, Cochin University of Science and Technology

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Eight hundred and eighty-¢ve strains of bacterial isolates fromvarious samples associatedwith the natural habitat ofMacrobrachiumrosenbergii were screened for their probiotic potential. Two putative probionts namely Bacillus NL110 and Vibrio NE17 isolated from the larvae and egg samples, respectively, were selected for experimental studies and were introduced to the juveniles of M. rosenbergii (0.080 0.001g) through di¡erent modes such as through feed, water and both. The probiotic potential of the above bacteria in terms of improvements inwater quality, growth, survival, speci¢c growth rate (SGR), feed conversion ratio and immune parameters was evaluated. The treatment groups showed a signi¢cant improvement in SGR and weight gain (Po0.001). Survival among di¡erent treatment groups was better than that in the control group. There were also signi¢cant improvements in the water quality parameters such as the concentration of nitrate and ammonia in the treatment groups (Po0.05). Improvements in immune parameters such as the total haemocyte count (Po0.05), phenoloxidase activity and respiratory burst were also signi¢cant (Po0.001). It is concluded that screening of the natural micro£ora of cultured ¢sh and shell¢sh for putative probionts might yield probiotic strains of bacteria that could be utilized for an environment-friendly and organic mode of aquaculture.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Eight hundred and eighty-¢ve strains of bacterial isolates fromvarious samples associatedwith the natural habitat ofMacrobrachiumrosenbergii were screened for their probiotic potential. Two putative probionts namely Bacillus NL110 and Vibrio NE17 isolated from the larvae and egg samples, respectively, were selected for experimental studies and were introduced to the juveniles of M. rosenbergii (0.080 0.001g) through di¡erent modes such as through feed, water and both. The probiotic potential of the above bacteria in terms of improvements inwater quality, growth, survival, speci¢c growth rate (SGR), feed conversion ratio and immune parameters was evaluated. The treatment groups showed a signi¢cant improvement in SGR and weight gain (Po0.001). Survival among di¡erent treatment groups was better than that in the control group. There were also signi¢cant improvements in the water quality parameters such as the concentration of nitrate and ammonia in the treatment groups (Po0.05). Improvements in immune parameters such as the total haemocyte count (Po0.05), phenoloxidase activity and respiratory burst were also signi¢cant (Po0.001). It is concluded that screening of the natural micro£ora of cultured ¢sh and shell¢sh for putative probionts might yield probiotic strains of bacteria that could be utilized for an environment-friendly and organic mode of aquaculture

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The thesis deals with the prevalence and distribution of motile aeromonads in selected ornamental fishes. The presence of motile aeromonads in ornamental fishes and associated carriage water is well documented. Though aeromonads are a part of autochthonous flora of natural waters, disease outbreak occurs as a result of environmental stress on the cultured species and virulence of the pathogens. While ornamental aquaculture in many parts of the world is highly organized and practiced scientifically, it is highly unorganized in India. The culture ponds/tanks are often maintained in very poor manner and the fishes are subjected to high degree of stress during transportation from the production facility to retail vendors. The situation is no better at retail outlets, where fishes are maintained in crowded condition without proper aeration or food. All these could result in high prevalence of diseases caused by motile aeromonads. No systematic study has been carried out to understand the prevalence of motile aeromonads in ornamental fishes and carriage water . It also gives an account of the production of extracellular virulence factors and the antibiogram of the different species of motile aeromonads isolated. The growth characteristics and virulence potential of a representative strain of Aeromonas hydrophila is also studied. The nucleotide sequencing of the strain was carried out and sequences deposited in Genbank. Survival and immune response of Cyprinus carpio under different stress conditions and on probiotic treatment with Bacillus NL110, when challenged with A. hydrophila is also dealt within this thesis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study aimed at evaluating the effects of different levels of rosemary (Rosmarinus officinalis) extract on growth rate, hematology and cell-mediated immune response in Markhoz newborn goat kids. Twenty four goat kids (aged 7 +/- 3 days) were randomly allotted to four groups with six replicates. The groups included: control, T1, T2 and T3 groups which received supplemented-milk with 0, 100, 200 and 400mg aqueous rosemary extract per kg of live body weight per day for 42 days. Body weights of kids were measured weekly until the end of the experiment. On day 42, 10 ml blood samples were collected from each kid through the jugular vein. Cell-mediated immune response was assessed through the double skin thickness after intradermal injection of phyto-hematoglutinin (PHA) at day 21 and 42. No significant differences were seen in initial body weight, average daily gain (ADG) and total gain. However, significant differences in globulin (P <0.05), and white blood cells (WBC) (P <0.001) were observed. There were no significant differences in haemoglobin (Hb), packed cell volume (PCV), red blood cells (RBC), lymphocytes and neutrophils between the treatments. Skin thickness in response to intra dermal injection of PHA significantly increased in the treated groups as compared to the control group at day 42 (P< 0.01) with the T3 group showing the highest response to PHA injection. In conclusion, the results indicated that aqueous rosemary extract supplemented-milk had a positive effect on immunity and skin thickness of newborn goat kids.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The outer domain (OD) of human immunodeficiency virus (HIV)-1 gp120 represents an attractive, if difficult, target for a beneficial immune response to HIV infection. Unlike the entire gp120, the OD is structurally stable and contains the surfaces that interact with both the primary and secondary cellular receptors. The primary strain-specific neutralizing target, the V3 loop, lies within the OD, as do epitopes for two cross-reactive neutralizing monoclonal antibodies (mAbs), b12 and 2G12, and the contact sites for a number of inhibitory lectins. The OD is poorly immunogenic, at least in the context of complete gp120, but purposeful OD immunization can lead to a substantial antibody response. Here, we map the antibody generated following immunization with a clade C OD. In contrast to published data for the clade B OD, the majority of the polyclonal response to the complete clade C OD is to the V3 loop; deletion of the loop substantially reduces immunogenicity. When the loop sequence was substituted for the epitope for 2F5, a well-characterized human cross-neutralizing mAb, a polyclonal response to the epitope was generated. A panel of mAbs against the clade C OD identified two mAbs that reacted with the loop and were neutralizing for clade C but not B isolates. Other mAbs recognized both linear and conformational epitopes in the OD. We conclude that, as for complete gp120, V3 immunodominance is a property of OD immunogens, that the responses can be neutralizing and that it could be exploited for the presentation of other epitopes.