Representational pseudoneglect and reference points both influence geographic location estimates

Our mental representation of the world is far from objective. For example, western Canadians estimate the locations of North American cities to be too far to the west. This bias could be due to a reference point effect, in which people estimate more space between places close to them than far from them, or to representational pseudoneglect, in which neurologically intact individuals favor the left side of space when asked to image a scene.We tested whether either or both of these biases influence the geographic world representations of neurologically intact young adults from Edmonton and Ottawa, which are in western and eastern Canada, respectively. Individuals were asked to locate NorthAmerican cities on a two-dimensional grid. Both groups revealed effects of representational pseudoneglect in this novel paradigm, but they also each exhibited reference point effects. These results inform theories in both cognitive psychology and neuroscience.

An illustration of the ALLOC 6B location-allocation analysis system, 1984

The programs included in this Discussion Paper no. 17 are Distance, Unravel, Retrench and Alloc 6B that deal with location-allocation analyses first published in 1973 by the Department of Geography, The University of Iowa.

Location referencing system team report : final report, 1998

This report is a culmination of the Location Referencing System (LRS) team. The team was charged with defining a system that coordinates the collection storage, and access to location referencing information by developing an LRS to be used throughout the Iowa DOT.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relationship between estrogen receptor alpha location and gene induction reveals the importance of downstream sites and cofactors.

BACKGROUND: To understand cancer-related modifications to transcriptional programs requires detailed knowledge about the activation of signal-transduction pathways and gene expression programs. To investigate the mechanisms of target gene regulation by human estrogen receptor alpha (hERalpha), we combine extensive location and expression datasets with genomic sequence analysis. In particular, we study the influence of patterns of DNA occupancy by hERalpha on expression phenotypes. RESULTS: We find that strong ChIP-chip sites co-localize with strong hERalpha consensus sites and detect nucleotide bias near hERalpha sites. The localization of ChIP-chip sites relative to annotated genes shows that weak sites are enriched near transcription start sites, while stronger sites show no positional bias. Assessing the relationship between binding configurations and expression phenotypes, we find binding sites downstream of the transcription start site (TSS) to be equally good or better predictors of hERalpha-mediated expression as upstream sites. The study of FOX and SP1 cofactor sites near hERalpha ChIP sites shows that induced genes frequently have FOX or SP1 sites. Finally we integrate these multiple datasets to define a high confidence set of primary hERalpha target genes. CONCLUSION: Our results support the model of long-range interactions of hERalpha with the promoter-bound cofactor SP1 residing at the promoter of hERalpha target genes. FOX motifs co-occur with hERalpha motifs along responsive genes. Importantly we show that the spatial arrangement of sites near the start sites and within the full transcript is important in determining response to estrogen signaling.

Location-independent and location-linked representations of sound objects.

For the recognition of sounds to benefit perception and action, their neural representations should also encode their current spatial position and their changes in position over time. The dual-stream model of auditory processing postulates separate (albeit interacting) processing streams for sound meaning and for sound location. Using a repetition priming paradigm in conjunction with distributed source modeling of auditory evoked potentials, we determined how individual sound objects are represented within these streams. Changes in perceived location were induced by interaural intensity differences, and sound location was either held constant or shifted across initial and repeated presentations (from one hemispace to the other in the main experiment or between locations within the right hemispace in a follow-up experiment). Location-linked representations were characterized by differences in priming effects between pairs presented to the same vs. different simulated lateralizations. These effects were significant at 20-39 ms post-stimulus onset within a cluster on the posterior part of the left superior and middle temporal gyri; and at 143-162 ms within a cluster on the left inferior and middle frontal gyri. Location-independent representations were characterized by a difference between initial and repeated presentations, independently of whether or not their simulated lateralization was held constant across repetitions. This effect was significant at 42-63 ms within three clusters on the right temporo-frontal region; and at 165-215 ms in a large cluster on the left temporo-parietal convexity. Our results reveal two varieties of representations of sound objects within the ventral/What stream: one location-independent, as initially postulated in the dual-stream model, and the other location-linked.

Detection of metabolite induction in fungal co-cultures on solid media by high-throughput differential ultra-high pressure liquid chromatography-time-of-flight mass spectrometry fingerprinting.

Access to new biological sources is a key element of natural product research. A particularly large number of biologically active molecules have been found to originate from microorganisms. Very recently, the use of fungal co-culture to activate the silent genes involved in metabolite biosynthesis was found to be a successful method for the induction of new compounds. However, the detection and identification of the induced metabolites in the confrontation zone where fungi interact remain very challenging. To tackle this issue, a high-throughput UHPLC-TOF-MS-based metabolomic approach has been developed for the screening of fungal co-cultures in solid media at the petri dish level. The metabolites that were overexpressed because of fungal interactions were highlighted by comparing the LC-MS data obtained from the co-cultures and their corresponding mono-cultures. This comparison was achieved by subjecting automatically generated peak lists to statistical treatments. This strategy has been applied to more than 600 co-culture experiments that mainly involved fungal strains from the Fusarium genera, although experiments were also completed with a selection of several other filamentous fungi. This strategy was found to provide satisfactory repeatability and was used to detect the biomarkers of fungal induction in a large panel of filamentous fungi. This study demonstrates that co-culture results in consistent induction of potentially new metabolites.

GIS-Based Accident Location and Analysis System (GIS-ALAS) Project Report: Phase 1, 1998

This report summarizes progress made in Phase 1 of the GIS-based Accident Location and Analysis System (GIS-ALAS) project. The GIS-ALAS project builds on several longstanding efforts by the Iowa Department of Transportation (DOT), law enforcement agencies, Iowa State University, and several other entities to create a locationally-referenced highway accident database for Iowa. Most notable of these efforts is the Iowa DOT’s development of a PC-based accident location and analysis system (PC-ALAS), a system that has been well received by users since it was introduced in 1989. With its pull-down menu structure, PC-ALAS is more portable and user-friendly than its mainframe predecessor. Users can obtain accident statistics for locations during specified time periods. Searches may be refined to identify accidents of specific types or involving drivers with certain characteristics. Output can be viewed on a computer screen, sent to a file, or printed using pre-defined formats.

Classification and fingerprinting of different berries based on biochemical profiling and antioxidant capacity

The objective of this work was to evaluate the biochemical composition of six berry types belonging to Fragaria, Rubus, Vaccinium and Ribes genus. Fruit samples were collected in triplicate (50 fruit each) from 18 different species or cultivars of the mentioned genera, during three years (2008 to 2010). Content of individual sugars, organic acids, flavonols, and phenolic acids were determined by high performance liquid chromatography (HPLC) analysis, while total phenolics (TPC) and total antioxidant capacity (TAC), by using spectrophotometry. Principal component analysis (PCA) and hierarchical cluster analysis (CA) were performed to evaluate the differences in fruit biochemical profile. The highest contents of bioactive components were found in Ribes nigrum and in Fragaria vesca, Rubus plicatus, and Vaccinium myrtillus. PCA and CA were able to partially discriminate between berries on the basis of their biochemical composition. Individual and total sugars, myricetin, ellagic acid, TPC and TAC showed the highest impact on biochemical composition of the berry fruits. CA separated blackberry, raspberry, and blueberry as isolate groups, while classification of strawberry, black and red currant in a specific group has not occurred. There is a large variability both between and within the different types of berries. Metabolite fingerprinting of the evaluated berries showed unique biochemical profiles and specific combination of bioactive compound contents.

Mobile Communications within the European Union: The Role of Location in the Evolution and Forecasting of the Diffusion Process

In the European Union, the importance of mobile communications was realized early on. The process of mobile communications becoming ubiquitous has taken time, as the innovation of mobile communications diffused into the society. The aim of this study is to find out how the evolution and spatial patterns of the diffusion of mobile communications within the European Union could be taken into account in forecasting the diffusion process. There is relatively lot of research of innovation diffusion on the individual (micro) andthe country (macro) level, if compared to the territorial level. Territorial orspatial diffusion refers either to the intra-country or inter-country diffusionof an innovation. In both settings, the dif- fusion of a technological innovation has gained scarce attention. This study adds knowledge of the diffusion between countries, focusing especially on the role of location in this process. The main findings of the study are the following: The penetration rates of the European Union member countries have become more even in the period of observation, from the year 1981 to 2000. The common digital GSM system seems to have hastened this process. As to the role of location in the diffusion process, neighboring countries have had similar diffusion processes. They can be grouped into three, the Nordic countries, the central and southern European countries, and the remote southern European countries. The neighborhood effect is also domi- nating in thegravity model which is used for modeling the adoption timing of the countries. The subsequent diffusion within a country, measured by the logistic model in Finland, is af- fected positively by its economic situation, and it seems to level off at some 92 %. Considering the launch of future mobile communications systemsusing a common standard should implicate an equal development between the countries. The launching time should be carefully selected as the diffusion is probably delayed in economic downturns. The location of a country, measured by distance, can be used in forecasting the adoption and diffusion. Fi- nally, the result of penetration rates becoming more even implies that in a relatively homoge- nous set of countries, such as the European Union member countries, the estimated final pene- tration of a single country can be used for approximating the penetration of the others. The estimated eventual penetration of Finland, some 92 %, should thus also be the eventual level for all the European Union countries and for the European Union as a whole.

External Location Factors of Foreign Direct Investment in Russia – Finnish Perspective

Tämän diplomityön tavoitteena on selvittää, mitä alueellisia tekijöitä suomalaiset yritykset ottavat huomioon valitessaan sopivaa sijaintia suoralle investoinnille Venäjän sisällä. Muutamia yrityksen sisäisiä tekijöitä käytetään taustamuuttujina selittämään sijaintitekijöiden painotuksissa havaittavia eroja erilaisten yritysten välillä. Venäjän alueita vertaillaan lopuksi painotusten valossa. Työn ensimmäisessä osassa keskitytään suorien ulkomaisten investointien teoreettiseen taustaan. Aiempia tutkimuksia käydään läpi, jotta tekijät, joilla on havaittu olevan vaikutusta investointien sijoittumiseen maan sisällä, saadaan kartoitettua. Työn jälkimmäinen osa perustuu yrityskyselyn avulla kerättyyn empiiriseen aineistoon. Aineiston avulla selvitetään mitä tekijöitä suomalaisyritykset huomioivat sijaintipäätöstä tehdessään. Tulosten valossa on ilmeistä, että alueen markkinapotentiaali on suomalaisyrityksissä tärkein huomioitava tekijä investoinnin sijainnista päätettäessä. Myös infrastruktuuri ja kustannushyödyt vaikuttavat päätökseen. Erityyppisten yritysten painotukset ovat hyvin samanlaisia. Moskova ja Pietari vastaavat Venäjän alueista parhaiten suomalaisyritysten investoinnin sijainnille asettamia kriteerejä.

Privacy-friendly Business Models for Location-Based Mobile Services

This paper presents a theoretical model to analyze the privacy issues around location based mobile business models. We report the results of an exploratory field experiment in Switzerland that assessed the factors driving user payoff in mobile business. We found that (1) the personal data disclosed has a negative effect on user payoff; (2) the amount of personalization available has a direct and positive effect, as well as a moderating effect on user payoff; (3) the amount of control over user's personal data has a direct and positive effect, as well as a moderating effect on user payoff. The results suggest that privacy protection could be the main value proposition in the B2C mobile market. From our theoretical model we derive a set of guidelines to design a privacy-friendly business model pattern for third-party services. We discuss four examples to show the mobile platform can play a key role in the implementation of these new business models.

Business Model Considerations for Privacy Protection in a Mobile Location Based Context

In this paper we discuss the main privacy issues around mobile business models and we envision new solutions having privacy protection as a main value proposition. We construct a framework to help analyze the situation and assume that a third party is necessary to warrant transactions between mobile users and m-commerce providers. We then use the business model canvas to describe a generic business model pattern for privacy third party services. This pattern is then illustrated in two different variations of a privacy business model, which we call privacy broker and privacy management software. We conclude by giving examples for each business model and by suggesting further directions of investigation