Titrimetric and spectrophotometric assay of bupropion hydrochloride in pharmaceuticals using mercury(II) nitrate

Two simple, rapid and accurate methods for the determination of bupropion hydrochloride (BUP) in pure and in pharmaceutical preparations are described. Both methods are based on the measurement of the chloride of its hydrochloride. In the titrimetric method, the chloride content of bupropion hydrochloride is determined by titrating with mercury(II)nitrate using diphenylcarbazone-bromophenol blue as indicator. Titrimetric method is applicable over a range 2-20 mg of BUP and the reaction stoichiometry is found to be 2:1 (BUP: Hg(NO3)2). The spectrophotometric method involves the addition of a measured excess of mercury(II) nitrate reagent in formate buffer to the drug, and after ensuring the reaction had gone to completion, the unreacted mercury(II) is treated with a fixed amount of diphenylcarbazone, and absorbance measured at 515 nm. The absorbance is found to decrease linearly with increasing concentration of BUP and the calibration curve is linear over 1.0-15.0 µg mL-1 BUP. The proposed methods were successfully applied to the determination of BUP in commercially available dosage forms with good accuracy and precision, and without detectable interference by excipients. The accuracy was further ascertained by placebo blank and synthetic mixture analyses and also by recovery experiments via standard-addition procedure.

New reagents for the spectrophotometric determination of ranitidine hydrochloride

A new spectrophotometric method is proposed for the assay of ranitidine hydrochloride (RNH) in bulk drug and in its dosage forms using ceric ammonium sulphate (CAS) and two dyes, malachite (MAG) green and crystal violet (CV) as reagents. The method involves the addition of a known excess of ceric ammonium sulphate to ranitidine hydrochloride in acid medium, followed by the determination of unreacted CAS by reacting with a fixed amount of malachite green or crystal violet and measuring the absorbance at 615 or 582 nm respectively against the reagent blank. The Beer's law is obeyed in the concentration range of 0.4-8.0 µg/ ml of ranitidine hydrochloride (RNH) for RNH-MAG system and 0.2-1.6µg/ml of ranitidine hydrochloride for RNH-CV system. The molar Absorptivity, Sandell's sensitivity for each system were calculated. The method has been successfully applied to the determination of ranitidine hydrochloride in pure and dosage forms.

A propósito de cenários e atores: de que peça estamos falando? Uma luz diferente sobre o cenário da prática dos médicos em formação

O médico moderno precisa aguçar seus atributos humanos, adaptar-se a contextos variados e manter a educação permanente. A formação médica não costuma ocorrer no contexto da prática clínica real, mas no hospital, com ênfase na doença. As Diretrizes Curriculares Nacionais dos Cursos de Graduação em Medicina preconizam a articulação entre a universidade e o sistema de saúde e a habilitação à educação permanente. Logo, os cenários da prática devem ser os ambulatórios próprios dos serviços de saúde, com um aprendizado voltado para as necessidades de saúde da comunidade. Existe hoje um fortalecimento da Medicina Clínica Acadêmica, que combina cuidados de saúde com pesquisa, ensino e administração. O aluno deve assimilar a visão moderna da relação médico-paciente, respeitando as decisões compartilhadas, tarefa que exige trabalhar habilidades em comunicação. As instituições de ensino e de assistência à saúde são coadjuvantes neste processo, bem como os meios de comunicação. A inserção no cenário da prática médica tem que ser integrada a todas as disciplinas do curso, permeando o currículo e permitindo que o estudante volte sua atenção para as necessidades de saúde da comunidade. Estabelecer um currículo inovador exige que os educadores compreendam o esgotamento do modelo tradicional de ensino, fundamentado na doença e na transmissão de conhecimentos, que afasta o aluno da visão prática da Medicina. O enfoque pedagógico moderno enfatiza aspectos formativos. Seus principais domínios são: comportamento do paciente, atitude e papel do médico, interações médico-paciente e fatores socioculturais relativos aos cuidados com a saúde.

Diversidade genética entre indivíduos de Spondias lutea L. procedentes do baixo são francisco sergipano, por meio de marcadores rapd

A recuperação de matas ciliares com mudas que apresentam o máximo de diversidade genética possível é de suma importância para a conservação das espécies. Assim, este estudo foi realizado com o objetivo de caracterizar geneticamente, por meio de marcadores RAPD, indivíduos de Spondias lutea L. (cajá), com a finalidade de elaborar estratégias de produção de sementes para a recuperação de mata ciliar. O estudo foi realizado em uma área de mata ciliar no Baixo São Francisco sergipano, onde foi coletado material foliar de 17 indivíduos para a análise de RAPD. A extração de DNA foi realizada por meio de tampão CTAB 2%, e para a geração de polimorfismo foram empregados 17 oligonucleotídios. A matriz binária construída com presença (1) e ausência de bandas (0) foi usada para o cálculo da estimativa de similaridade genética e, a partir desta, foi feita a representação simplificada das similaridades, pelo método de agrupamento UPGMA, e a estabilidade dos agrupamentos foi testada pela análise "bootstrap". Para visualização da divergência entre os indivíduos, realizou-se o agrupamento dos indivíduos pelo método de Tocher. A matriz de distância genética foi comparada com a matriz de distância geográfica pelo teste de Mantel, com a finalidade de verificar se há correlação entre as mesmas. A similaridade genética média entre os indivíduos foi de 46,8%, e a amplitude das similaridades variou de 21 a 78%. Não houve associação entre as distâncias genéticas e geográficas (r = 0,08). Com o método de agrupamento de Tocher, houve a formação de cinco grupos e o valor mínimo de similaridade calculado, acima do qual os indivíduos são considerados geneticamente iguais, foi igual a 91%. Assim, os indivíduos analisados são considerados divergentes e podem ser utilizados como matrizes porta-sementes em programas de produção de sementes para a recuperação de mata ciliar.

The sources of complementary competitive advantages for systems’ manufacturers in the aircraft modernization market

Being a top of high technology industries, the aerospace represents one of the most complex fields of study. While the competitiveness of aircraft systems’ manufacturers attracts a significant number of researchers, some of the issues remain to be a blank spot. One of those is the after-sale modernization. The master thesis investigates how this concept is related to the theory of competitive advantages. Finding the routes in the framework of complex technological systems’ lifecycle, the key drivers of the aircraft modernization market are revealed. The competitive positioning of players is defined through multiple case studies in a form of several in-depth interviews. The key result of the research is the conclusion that modernization should be considered as an inherent component of strategy of any aircraft systems’ manufacturer, while the master thesis aims to support managerial decision making.

PDM system functions and utilizations analysis to improve efficiency of sheet metal product design and manufacturing

This study will concentrate on Product Data Management (PDM) systems, and sheet metal design features and classification. In this thesis, PDM is seen as an individual system which handles all product-related data and information. The meaning of relevant data is to take the manufacturing process further with fewer errors. The features of sheet metals are giving more information and value to the designed models. The possibility of implementing PDM and sheet metal features recognition are the core of this study. Their integration should make the design process faster and manufacturing-friendly products easier to design. The triangulation method is the basis for this research. The sections of this triangle are: scientific literature review, interview using the Delphi method and the author’s experience and observations. The main key findings of this study are: (1) the area of focus in triangle (the triangle of three different point of views: business, information exchange and technical) depends on the person’s background and their role in the company, (2) the classification in the PDM system (and also in the CAD system) should be done using the materials, tools and machines that are in use in the company and (3) the design process has to be more effective because of the increase of industrial production, sheet metal blank production and the designer’s time spent on actual design and (4) because Design For Manufacture (DFM) integration can be done with CAD-programs, DFM integration with the PDM system should also be possible.

A simple HPLC-fluorescence method for the measurement of R,S-sotalol in the plasma of patients with life-threatening cardiac arrhythmias

R,S-sotalol, a ß-blocker drug with class III antiarrhythmic properties, is prescribed to patients with ventricular, atrial and supraventricular arrhythmias. A simple and sensitive method based on HPLC-fluorescence is described for the quantification of R,S-sotalol racemate in 500 µl of plasma. R,S-sotalol and its internal standard (atenolol) were eluted after 5.9 and 8.5 min, respectively, from a 4-micron C18 reverse-phase column using a mobile phase consisting of 80 mM KH2PO4, pH 4.6, and acetonitrile (95:5, v/v) at a flow rate of 0.5 ml/min with detection at lex = 235 nm and lem = 310 nm, respectively. This method, validated on the basis of R,S-sotalol measurements in spiked blank plasma, presented 20 ng/ml sensitivity, 20-10,000 ng/ml linearity, and 2.9 and 4.8% intra- and interassay precision, respectively. Plasma sotalol concentrations were determined by applying this method to investigate five high-risk patients with atrial fibrillation admitted to the Emergency Service of the Medical School Hospital, who received sotalol, 160 mg po, as loading dose. Blood samples were collected from a peripheral vein at zero, 0.5, 1.0, 1.5, 2.0, 3.0, 4.0, 6.0, 8.0, 12.0 and 24.0 h after drug administration. A two-compartment open model was applied. Data obtained, expressed as mean, were: CMAX = 1230 ng/ml, TMAX = 1.8 h, AUCT = 10645 ng h-1 ml-1, Kab = 1.23 h-1, a = 0.95 h-1, ß = 0.09 h-1, t(1/2)ß = 7.8 h, ClT/F = 3.94 ml min-1 kg-1, and Vd/F = 2.53 l/kg. A good systemic availability and a fast absorption were obtained. Drug distribution was reduced to the same extent in terms of total body clearance when patients and healthy volunteers were compared, and consequently elimination half-life remained unchanged. Thus, the method described in the present study is useful for therapeutic drug monitoring purposes, pharmacokinetic investigation and pharmacokinetic-pharmacodynamic sotalol studies in patients with tachyarrhythmias.

Tracheal instillation of urban PM2.5 suspension promotes acute cardiac polarization changes in rats

The mechanisms by which PM2.5 increases cardiovascular mortality are not fully identified. Autonomic alterations are the current main hypotheses. Our objective was to determine if PM2.5 induces acute cardiac polarization alterations in healthy Wistar rats. PM2.5 samples were collected on polycarbonate filters. Solutions containing 10, 20, and 50 µg PM2.5 were administered by tracheal instillation. P wave duration decreased significantly at 20 µg (0.99 ± 0.06, 0.95 ± 0.06, and 0.96 ± 0.07; P < 0.001), and 50 µg (0.98 ± 0.06, 0.98 ± 0.07, and 0.96 ± 0.08; 60, 90 and 120 min, respectively) compared to blank filter solution (P < 0.001). PR interval duration decreased significantly at 20 µg (0.99 ± 0.06, 0.98 ± 0.07, and 0.97 ± 0.08) and 50 µg (0.99 ± 0.05, 0.97 ± 0.0, and 0.95 ± 0.05; 60, 90, and 120 min, respectively) compared to blank filter and 10 µg (P < 0.001). QRS interval duration decreased at 20 and 50 µg in relation to blank filter solution and 10 µg (P < 0.001). QT interval duration decreased significantly (P < 0.001) with time in animals receiving 20 µg (0.94 ± 0.12, 0.88 ± 0.14, and 0.88 ± 0.11) and 50 µg (1.00 ± 0.13; 0.97 ± 0.11 and 0.98 ± 0.16; 60, 90 and 120 min, respectively) compared to blank filter solution and 10 µg (P < 0.001). PM2.5 induced reduced cardiac conduction time, within a short period, indicating that depolarization occurs more rapidly across ventricular tissue.

Severity score system for progressive myelopathy: development and validation of a new clinical scale

Progressive myelopathies can be secondary to inborn errors of metabolism (IEM) such as mucopolysaccharidosis, mucolipidosis, and adrenomyeloneuropathy. The available scale, Japanese Orthopaedic Association (JOA) score, was validated only for degenerative vertebral diseases. Our objective is to propose and validate a new scale addressing progressive myelopathies and to present validating data for JOA in these diseases. A new scale, Severity Score System for Progressive Myelopathy (SSPROM), covering motor disability, sphincter dysfunction, spasticity, and sensory losses. Inter- and intra-rater reliabilities were measured. External validation was tested by applying JOA, the Expanded Disability Status Scale (EDSS), the Barthel index, and the Osame Motor Disability Score. Thirty-eight patients, 17 with adrenomyeloneuropathy, 3 with mucopolysaccharidosis I, 3 with mucopolysaccharidosis IV, 2 with mucopolysaccharidosis VI, 2 with mucolipidosis, and 11 with human T-cell lymphotropic virus type-1 (HTLV-1)-associated myelopathy participated in the study. The mean ± SD SSPROM and JOA scores were 74.6 ± 11.4 and 12.4 ± 2.3, respectively. Construct validity for SSPROM (JOA: r = 0.84, P < 0.0001; EDSS: r = -0.83, P < 0.0001; Barthel: r = 0.56, P < 0.002; Osame: r = -0.94, P < 0.0001) and reliability (intra-rater: r = 0.83, P < 0.0001; inter-rater: r = 0.94, P < 0.0001) were demonstrated. The metric properties of JOA were similar to those found in SSPROM. Several clinimetric requirements were met for both SSPROM and JOA scales. Since SSPROM has a wider range, it should be useful for follow-up studies on IEM myelopathies.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effect of microRNA-21 on the proliferation of human degenerated nucleus pulposus by targeting programmed cell death 4

This study aims to explore the effect of microRNA-21 (miR-21) on the proliferation of human degenerated nucleus pulposus (NP) by targeting programmed cell death 4 (PDCD4) tumor suppressor. NP tissues were collected from 20 intervertebral disc degeneration (IDD) patients, and from 5 patients with traumatic spine fracture. MiR-21 expressions were tested. NP cells from IDD patients were collected and divided into blank control group, negative control group (transfected with miR-21 negative sequences), miR-21 inhibitor group (transfected with miR-21 inhibitors), miR-21 mimics group (transfected with miR-21 mimics) and PDCD4 siRNA group (transfected with PDCD4 siRNAs). Cell growth was estimated by Cell Counting Kit-8; PDCD4, MMP-2,MMP-9 mRNA expressions were evaluated by qRT-PCR; PDCD4, c-Jun and p-c-Jun expressions were tested using western blot. In IDD patients, the expressions of miR-21 and PDCD4 mRNA were respectively elevated and decreased (both P<0.05). The miR-21 expressions were positively correlated with Pfirrmann grades, but negatively correlated with PDCD4 mRNA (both P<0.001). In miR-21 inhibitor group, cell growth, MMP-2 and MMP-9 mRNA expressions, and p-c-Jun protein expressions were significantly lower, while PDCD4 mRNA and protein expressions were higher than the other groups (all P<0.05). These expressions in the PDCD4 siRNA and miR-21 mimics groups was inverted compared to that in the miR-21 inhibitor group (all P<0.05). MiR-21 could promote the proliferation of human degenerated NP cells by targeting PDCD4, increasing phosphorylation of c-Jun protein, and activating AP-1-dependent transcription of MMPs, indicating that miR-21 may be a crucial biomarker in the pathogenesis of IDD.

Lipid and protein oxidation in the internal part of italian type salami containing basil essential oil (Ocimum basilicum L.)

Different concentrations of basil essential oil (Ocimum basilicum L.) (0.19; 0.38; 0.75; 1.87; 3.75 and 6.00 mg.g-1) were evaluated in relation to their antioxidant activity using the DPPH● radical methodology. From the IC50 obtained data, the concentrations of 0.19; 0.38; 0.75; 1.87; 3.75; 6.00 and 12.00 mg.mL-1 were applied directly to the product and these were sensorially evaluated by the test of control difference. The concentrations related to the highest acceptability (0.19; 0.38 and 0.75 mg.g-1) were tested for antioxidant activity in the internal part of Italian type salami - during the processing and after 30 days of storage, in terms of lipid and protein oxidation. The oxidation of lipids was determined using the method of TBARS. The method of carbonyl compounds was employed for proteins oxidation. Five different formulations of salami were elaborated: blank (without the use of antioxidant); control (using sodium eritorbate as antioxidant); and adding 0.19; 0.38 and 0.75 mg.g-1 of basil essential oil. The product was kept between 25 ºC and 18 ºC and UR between 95% and 70%, for 28 days. Analyses were carried out on the processing day and after 2, 7, 14, 21 and 28 days, and also following 30 days of storage. The basil essential oil in vitro presented an antioxidant activity of IC50 12 mg.mL-1. In the internal part of the Italian type salami the commercial antioxidant (control) and the formulation containing 0.75 mg.g-1 of basil essential oil presented antioxidant activity in relation to the lipids, but not to the proteins - during processing and storage.

Press forming of paperboard – advancement of converting tools and process control

Press forming is nowadays one of the most common industrial methods in use for producing deeper trays from paperboard. Demands for material properties like recyclability and sustainability have increased also in the packaging industry, but there are still limitations related to the formability of paperboard. A majority of recent studies have focused on material development, but the potential of the package manufacturing process can also be improved by the development of tooling and process control. In this study, advanced converting tools (die cutting tools and the press forming mould) are created for production scale paperboard tray manufacturing. Also monitoring methods that enable the production of paperboard trays with enhanced quality, and can be utilized in process control are developed. The principles for tray blank preparation, including creasing pattern and die cutting tool design are introduced. The mould heating arrangement and determination of mould clearance are investigated to improve the quality of the press formed trays. The effect of the spring back of the tray walls on the tray dimensions can be managed by adjusting the heat-related process parameters and estimating it at the mould design stage. This enables production speed optimization as the process parameters can be adjusted more freely. Real-time monitoring of pressing force by using multiple force sensors embedded in the mould structure can be utilized in the evaluation of material characteristics on a modified production machinery. Comprehensive process control can be achieved with a combination of measurement of the outer dimensions of the trays and pressing force monitoring. The control method enables detection of defects and tracking changes in the material properties. The optimized converting tools provide a basis for effective operation of the control system.

Leak-proof Heat Sealing of Press-Formed Paperboard Trays

Three-dimensional (3D) forming of paperboard and heat sealing of lidding films to trays manufactured by the press forming process are investigated in this thesis. The aim of the work was to investigate and recognize the factors affecting the quality of heat sealing and the leak resistance (tightness) of press-formed, polymer-coated paperboard trays heatsealed with a multi-layer polymer based lidding film. One target was to achieve a solution that can be used in food packaging using modified atmosphere packaging (MAP). The main challenge in acquiring adequate tightness properties for the use of MAP is creases in the sealing area of the paperboard trays which can act as capillary tubes and prevent leak-proof sealing. Several experiments were made to investigate the effect of different factors and process parameters in the forming and sealing processes. Also different methods of analysis, such as microscopic analysis and 3D-profilometry were used to investigate the structure of the creases in the sealing area, and to analyse the surface characteristics of the tray flange of the formed trays to define quality that can be sealed with satisfactory tightness for the use of MAP. The main factors and parameters that had an effect on the result of leak-proof sealing and must be adjusted accordingly were the tray geometry and dimensions, blank holding force in press forming, surface roughness of the sealing area, the geometry and depth of the creases, and the sealing pressure. The results show that the quality of press-formed, polymer-coated paperboard trays and multi-layer polymer lidding films can be satisfactory for the use of modified atmosphere packaging in food solutions. Suitable tools, materials, and process parameters have to be selected and used during the tray manufacturing process and lid sealing process, however. Utilizing these solutions and results makes it possible for a package that is made mostly from renewable and recyclable sources to be a considerable alternative for packages made completely from oil based polymers, and to achieve a greater market share for fibre-based solutions in food packaging using MAP.

Emptying the bell jar: an exploration of adolescent responses to a women's literature unit /

This study examines adolescent student responses to a women's literature unit taught within a grade 12 Writer's Craft course. Current research (Gilligan, 1989, Pipher, 1994 & Slack, 1999) suggests that there is a great under-representation of female authors in the high school literature curriculum. The use of women's literature may draw attention to important literary figures who are historically overlooked within the curriculum. It gives voice to a marginalized group and presents students with alternative subjects and heroes. It encourages students to develop a critical perspective and reevaluate assumptions about institutions, ideologies, language and culture. It also allows me, as a teacher, to reflect on my own teaching practices and explore alternate feminist pedagogical principles and teaching styles encouraging multiplicity of voices, deconstruction of power relations, and alternative assessment tools within the classroom. As an educator, it is important for me to teach curriculum that is relevant and meaningful to students and help them become critical, self-reflective thinkers. It is also important for me to assist students in their exploration of self and encourage them to expand their awareness of historical, social and global issues. Sylvia Plath's (1963) The belljar is used as the primary text taught within this unit. In this novel, the bell jar is a central image that signifies entrapment and isolation. "To the person in the bell jar, blank and stopped as a dead body, the world itself is the bad dream"(p.l 54). As a metaphor, the bell jar resonates with young readers in a variety of ways.