Toward the therapeutic editing of mutated RNA sequences.

If RNA editing could be rationally directed to mutated RNA sequences, genetic diseases caused by certain base substitutions could be treated. Here we use a synthetic complementary RNA oligonucleotide to direct the correction of a premature stop codon mutation in dystrophin RNA. The complementary RNA oligonucleotide was hybridized to a premature stop codon and the hybrid was treated with nuclear extracts containing the cellular enzyme double-stranded RNA adenosine deaminase. When the treated RNAs were translated in vitro, a dramatic increase in expression of a downstream luciferase coding region was observed. The cDNA sequence data are consistent with deamination of the adenosine in the UAG stop codon to inosine by double-stranded RNA adenosine deaminase. Injection of oligonucleotide-mRNA hybrids into Xenopus embryos also resulted in an increase in luciferase expression. These experiments demonstrate the principle of therapeutic RNA editing.

A human RNase E-like activity that cleaves RNA sequences involved in mRNA stability control.

We have detected an endoribonucleolytic activity in human cell extracts that processes the Escherichia coli 9S RNA and outer membrane protein A (ompA) mRNA with the same specificity as RNase E from E. coli. The human enzyme was partially purified by ion-exchange chromatography, and the active fractions contained a protein that was detected with antibodies shown to recognize E. coli RNase E. RNA containing four repeats of the destabilizing motif AUUUA and RNA from the 3' untranslated region of human c-myc mRNA were also found to be cleaved by E. coli RNase E and its human counterpart in a fashion that may suggest a role of this activity in mammalian mRNA decay. It was also found that RNA containing more than one AUUUA motif was cleaved more efficiently than RNA with only one or a mutated motif. This finding of a eukaryotic endoribonucleolytic activity corresponding to RNase E indicates an evolutionary conservation of the components of mRNA degradation systems.

Documentation of reticulate evolution in peonies (Paeonia) using internal transcribed spacer sequences of nuclear ribosomal DNA: implications for biogeography and concerted evolution.

The internal transcribed spacers (ITS) of nuclear ribosomal DNA of 33 species of genus Paeonia (Paeoniaceae) were sequenced. In section Paeonia, different patterns of nucleotide additivity were detected in 14 diploid and tetraploid species at sites that are variable in the other 12 species of the section, suggesting that reticulate evolution has occurred. Phylogenetic relationships of species that do not show additivity, and thus ostensibly were not derived through hybridization, were reconstructed by parsimony analysis. The taxa presumably derived through reticulate evolution were then added to the phylogenetic tree according to additivity from putative parents. The study provides an example of successfully using ITS sequences to reconstruct reticulate evolution in plants and further demonstrates that the sequence data could be highly informative and accurate for detecting hybridization. Maintenance of parental sequences in the species of hybrid origin is likely due to slowing of concerted evolution caused by the long generation time of peonies. The partial and uneven homogenization of parental sequences displayed in nine species of putative hybrid origin may have resulted from gradients of gene conversion. The documented hybridizations may have occurred since the Pleistocene glaciations. The species of hybrid origin and their putative parents are now distantly allopatric. Reconstruction of reticulate evolution with sequence data, therefore, provides gene records for distributional histories of some of the parental species.

Isolation of multiple sequences from the Plasmodium falciparum genome that encode conserved domains homologous to those in erythrocyte-binding proteins.

Open reading frames in the Plasmodium falciparum genome encode domains homologous to the adhesive domains of the P. falciparum EBA-175 erythrocyte-binding protein (eba-175 gene product) and those of the Plasmodium vivax and Plasmodium knowlesi Duffy antigen-binding proteins. These domains are referred to as Duffy binding-like (DBL), after the receptor that determines P. vivax invasion of Duffy blood group-positive human erythrocytes. Using oligonucleotide primers derived from short regions of conserved sequence, we have developed a reverse transcription-PCR method that amplifies sequences encoding the DBL domains of expressed genes. Products of these reverse transcription-PCR amplifications include sequences of single-copy genes (including eba-175) and variably transcribed genes that cross-hybridize to multiple regions of the genome. Restriction patterns of the multicopy genes show a high degree of polymorphism among different parasite lines, whereas single-copy genes are generally conserved. Characterization of the single-copy genes has identified a gene (ebl-1) that is related to eba-175 and is likely to be involved in erythrocyte invasion.

Evidence for five divergent thioredoxin h sequences in Arabidopsis thaliana.

Five different clones encoding thioredoxin homologues were isolated from Arabidopsis thaliana cDNA libraries. On the basis of the sequences they encode divergent proteins, but all belong to the cytoplasmic thioredoxins h previously described in higher plants. The five proteins obtained by overexpressing the coding sequences in Escherichia coli present typical thioredoxin activities (NADP(+)-malate dehydrogenase activation and reduction by Arabidopsis thioredoxin reductase) despite the presence of a variant active site, Trp-Cys-Pro-Pro-Cys, in three proteins in place of the canonical Trp-Cys-Gly-Pro-Cys sequence described for thioredoxins in prokaryotes and eukaryotes. Southern blots show that each cDNA is encoded by a single gene but suggest the presence of additional related sequences in the Arabidopsis genome. This very complex diversity of thioredoxins h is probably common to all higher plants, since the Arabidopsis sequences appear to have diverged very early, at the beginning of plant speciation. This diversity allows the transduction of a redox signal into multiple pathways.

Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Proline-rich sequences that bind to Src homology 3 domains with individual specificities.

To study the binding specificity of Src homology 3 (SH3) domains, we have screened a mouse embryonic expression library for peptide fragments that interact with them. Several clones were identified that express fragments of proteins which, through proline-rich binding sites, exhibit differential binding specificity to various SH3 domains. Src-SH3-specific binding uses a sequence of 7 aa of the consensus RPLPXXP, in which the N-terminal arginine is very important. The SH3 domains of the Src-related kinases Fyn, Lyn, and Hck bind to this sequence with the same affinity as that of the Src SH3. In contrast, a quite different proline-rich sequence from the Btk protein kinase binds to the Fyn, Lyn, and Hck SH3 domains, but not to the Src SH3. Specific binding of the Abl SH3 requires a longer, more proline-rich sequence but no arginine. One clone that binds to both Src and Abl SH3 domains through a common site exhibits reversed binding orientation, in that an arginine indispensable for binding to all tested SH3 domains occurs at the C terminus. Another clone contains overlapping yet distinct Src and Abl SH3 binding sites. Binding to the SH3 domains is mediated by a common PXXP amino acid sequence motif present on all ligands, and specificity comes about from other interactions, often ones involving arginine. The rules governing in vivo usage of particular sites by particular SH3 domains are not clear, but one binding orientation may be more specific than another.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Promoter architecture in the flagellar regulon of Bacillus subtilis: high-level expression of flagellin by the sigma D RNA polymerase requires an upstream promoter element.

Flagellin is one of the most abundant proteins in motile bacteria, yet its expression requires a low abundance sigma factor (sigma 28). We show that transcription from the Bacillus subtilis flagellin promoter is stimulated 20-fold by an upstream A+T-rich region [upstream promoter (UP) element] both in vivo and in vitro. This UP element is contacted by sigma 28 holoenzyme bound at the flagellin promoter and binds the isolated alpha 2 subassembly of RNA polymerase. The UP element increases the affinity of RNA polymerase for the flagellin promoter and stimulates transcription when initiation is limited by the rate of RNA polymerase binding. Comparison with other promoters in the flagellar regulon reveals a bipartite architecture: the -35 and -10 elements confer specificity for sigma 28, while promoter strength is determined largely by upstream DNA sequences.

Alternative sign sequences for work zones on rural highways. Executive summary. Final report.

Federal Highway Administration, Office of Research and Development, Washington, D.C.

Engine test sequences for evaluating automotive lubricants for API service MS.

Mode of access: Internet.

Engine test sequences for evaluating automotive lubricants for API Service MS.

Beginning with 1971 ed. published under title: Multicylinder test sequencs for evaluating automotive engine oils.

A practical treatise on nervous exhaustion (neurasthenia), its symptoms, nature, sequences, treatment,

Mode of access: Internet.

Learning Models of Gene Expression from Synthetic DNA Sequences

Thesis (Ph.D.)--University of Washington, 2016-06

Role of flanking sequences and phosphorylation in the recognition of the simian-virus-40 large T-antigen nuclear localization sequences by importin-a

The nuclear import of simian-virus-40 large T-antigen (tumour antigen) is enhanced via phosphorylation by the protein kinase CK2 at Ser(112) in the vicinity of the NLS (nuclear localization sequence). To determine the structural basis of the effect of the sequences flanking the basic cluster KKKRK, and the effect of phosphorylation on the recognition of the NLS by the nuclear import factor importin-alpha (Impalpha), we co-crystallized non-autoinhibited Impalpha with peptides corresponding to the phosphorylated and non-phosphorylated forms of the NLS, and determined the crystal structures of the complexes. The structures show that the amino acids N-terminally flanking the basic cluster make specific contacts with the receptor that are distinct from the interactions between bipartite NLSs and Impalpha. We confirm the important role of flanking sequences using binding assays. Unexpectedly, the regions of the peptides containing the phosphorylation site do not make specific contacts with the receptor. Binding assays confirm that phosphorylation does not increase the affinity of the T-antigen NLS to Impalpha. We conclude that the sequences flanking the basic clusters in NLSs play a crucial role in nuclear import by modulating the recognition of the NLS by Impalpha, whereas phosphorylation of the T-antigen enhances nuclear import by a mechanism that does not involve a direct interaction of the phosphorylated residue with Impalpha.