250 resultados para Protonation
Resumo:
The ligands 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic-11-methylphosphonic acid (H(5)te3a1p) and 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic acid (H(3)te3a) were synthesized, the former one for the first time. The syntheses of these ligands were achieved from reactions on 1,4,8,11-tetraazacyclotetradecane-1,4,8-tris( carbamoylmethyl) hydroiodide (te3am center dot HI), and compounds (Hte3am)(+), 1, and (H(7)te3a1p)(2+), 4, were characterized by X-ray diffraction. Structures of two other compounds resulting from side-reactions, (H(2)te2lac)(2+), 2, and (H(4)te2a2p(OEt2))(2+), 3, were also determined by X-ray diffraction. Potentiometric titrations of H(5)te3a1p and H(3)te3a were performed at 298.2 K and ionic strength 0.10 mol dm(-3) in NMe4NO3 to determine their protonation constants. H-1 and P-31 NMR titrations of H(5)te3a1p were carried out in order to determine the very high first protonation constant of this ligand and to elucidate the sequence of protonation. Potentiometric studies of the two ligands with Ca2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ metal ions performed in the same experimental conditions showed that the complexes of H5te3a1p present very high thermodynamic stability while complexes of H(3)te3a, particularly Co2+ and Zn2+, are even more stable. P-31 NMR spectra of the cadmium(II) complex of H(5)te3a1p showed that the phosphonate moiety was coordinated to the metal ion. The UV-vis-NIR spectroscopic data and magnetic moment values of Co2+ and Ni2+ complexes of H(5)te3a1p and H(3)te3a together with the EPR of the corresponding Cu2+ complexes indicated that all these complexes adopt distorted octahedral coordination geometries in solution. This was confirmed by the single crystal structure of [Cu-2(Hte3a)(H2O)(3)Cl]Cl-0.5(ClO4)(0.5) center dot 2H(2)O that showed two distorted octahedral copper centres bridged by a N-acetate pendant arm with a Cu center dot center dot center dot Cu distance of 4.890(1) angstrom. The first one is encapsulated into the macrocyclic cavity surrounded by four nitrogen and two oxygen donors from the macrocycle, whereas the second one is on the periphery of the macrocycle and is coordinated to two oxygen atoms of one acetate pendant arm in chelating fashion, one chloride and three water molecules.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Electrochemical and photochemical properties of the tetrahedral cluster [Ru3Ir(mu(3)-H)(CO)(13)] were studied in order to prove whether the previously established thermal conversion of this cluster into the hydrogenated derivative [Ru3Ir(mu-H)(3)(CO)(12)] also occurs by means of redox or photochemical activation. Two-electron reduction of [Ru3Ir(mu(3)-H)(CO)(13)] results in the loss of CO and concomitant formation of the dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-). The latter reduction product is stable in CH2Cl2 at low temperatures but becomes partly protonated above 283 K into the anion [Ru3Ir(mu-H)(2)(CO)(12)](-) by traces of water. The dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-) is also the product of the electrochemical reduction of [Ru3Ir(mu-H)(3)(CO)(12)] accompanied by the loss of H-2. Stepwise deprotonation of [Ru3Ir(mu-H)(3)(CO)(12)] with Et4NOH yields [Ru3Ir(mu-H)(2)(CO)(12)](-) and [Ru3Ir(mu(3)-H)(CO)(12)](2-). Reverse protonation of the anionic clusters can be achieved, e. g., with trifluoromethylsulfonic acid. Thus, the electrochemical conversion of [Ru3Ir(mu(3)-H)(CO)(13)] into [Ru3Ir(mu-H)(3)(CO)(12)] is feasible, demanding separate two-electron reduction and protonation steps. Irradiation into the visible absorption band of [Ru3Ir(mu3-H)(CO)(13)] in hexane does not induce any significant photochemical conversion. Irradiation of this cluster in the presence of CO with lambda(irr) > 340 nm, however, triggers its efficient photofragmentation into reactive unsaturated ruthenium and iridium carbonyl fragments. These fragments are either stabilised by dissolved CO or undergo reclusterification to give homonuclear clusters. Most importantly, in H-2-saturated hexane, [Ru3Ir(mu(3)-H)(CO)(13)] converts selectively into the [Ru3Ir(mu-H)(3)(CO)(12)] photoproduct. This conversion is particularly efficient at lambda(irr) > 340 nm.
Resumo:
The rigid [6]ferrocenophane, L-1, was synthesised by condensation of 1,1'-ferrocene dicarbaldehyde with trans-1,2-diaminocyclohexane in high dilution at r.t. followed by reduction. When other experimental conditions were employed, the [6,6,6]ferrocenephane (L-2) was also obtained. Both compounds were characterised by single crystal X-ray crystallography. The protonation of L-1 and its metal complexation were evaluated by the effect on the electron-transfer process of the ferrocene (fc) unit of L-1 using cyclic voltammetry (CV) and square wave voltammetry (SWV) in anhydrous CH3CN solution and in 0.1 M (Bu4NPF6)-Bu-n as the supporting electrolyte. The electrochemical process of L-1 between 300 and 900 mV is complicated by amine oxidation. On the other hand, an anodic shift from the fc/fc(+) wave of L-1 of 249, 225, 81 and 61 mV was observed by formation of Zn2+, Ni2+, Pd2+ and Cu2+ complexes, respectively. Whereas Mg2+ and Ca2+ only have with L-1 weak interactions and they promote the acid-base equilibrium of L-1. This reveals that L-1 is an interesting molecular redox sensor for detection of Zn2+ and Ni2+, although the kinetics of the Zn2+ complex formation is much faster than that of the Ni2+ one. The X-ray crystal structure of [(PdLCl2)-Cl-1] was determined and showed a square-planar environment with Pd(II) and Fe(II) centres separated by 3.781(1) angstrom. The experimental anodic shifts were elucidated by DFT calculations on the [(MLCl2)-Cl-1] series and they are related to the nature of the HOMO of these complexes and a four-electron, two-orbital interaction.
Resumo:
The isotropic crystallographic model of the structure of xylanase I from Thermoascus aurantiacus (TAXI) has now been refined anisotropically at 1.14 Å resolution to a standard residual of R = 11.1% for all data. TAXI is amongst the five largest proteins deposited in the Protein Data Bank to have been refined with anisotropic displacement parameters (ADPs) at this level of resolution. The anisotropy analysis revealed a more isotropic distribution of anisotropy than usually observed previously. Adding ADPs resulted in high-quality electron-density maps which revealed discrepancies from the previously suggested primary sequences for this enzyme. Side-chain conformational disorder was modelled for 16 residues, including Trp275, a bulky residue at the active site. An unrestrained refinement was consistent with the protonation of the catalytic acid/base glutamate and the deprotonation of the nucleophile glutamate, as required for catalysis. The thermal stability of TAXI is reinterpreted in the light of the new refined model.
Resumo:
Two pentaaza macrocycles containing pyridine in the backbone, namely 3,6,9,12,18-pentaazabicyclo[12.3.1] octadeca-1(18),14,16-triene ([15]pyN(5)), and 3,6,10,13,19-pentaazabicyclo[13.3.1]nonadeca-1(19),15,17-triene ([16]pyN(5)), were synthesized in good yields. The acid-base behaviour of these compounds was studied by potentiometry at 298.2 K in aqueous solution and ionic strength 0.10 M in KNO3. The protonation sequence of [15]pyN(5) was investigated by H-1 NMR titration that also allowed the determination of protonation constants in D2O. Binding studies of the two ligands with Ca2+, Ni2+, Cu2+, Zn2+, Cd2+, and Pb2+ metal ions were performed under the same experimental conditions. The results showed that all the complexes formed with the 15-membered ligand, particularly those of Cu2+ and especially Ni2+, are thermodynamically more stable than with the larger macrocycle. Cyclic voltammetric data showed that the copper(II) complexes of the two macrocycles exhibited analogous behaviour, with a single quasi-reversible one-electron transfer reduction process assigned to the Cu(II)/Cu(I) couple. The UV-visible-near IR spectroscopic and magnetic moment data of the nickel(II) complexes in solution indicated a tetragonal distorted coordination geometry for the metal centre. X-band EPR spectra of the copper(II) complexes are consistent with distorted square pyramidal geometries. The crystal structure of [Cu([15]pyN(5))](2+) determined by X-ray diffraction showed the copper(II) centre coordinated to all five macrocyclic nitrogen donors in a distorted square pyramidal environment.
Resumo:
Group 6 complexes of the type [M(CO)4(bpy)] (M=Cr, Mo, W) are capable of behaving as electrochemical catalysts for the reduction of CO2 at potentials less negative than those for the reduction of the radical anions [M(CO)4(bpy)].−. Cyclic voltammetric, chronoamperometric and UV/Vis/IR spectro-electrochemical data reveal that five-coordinate [M(CO)3(bpy)]2− are the active catalysts. The catalytic conversion is significantly more efficient in N-methyl-2-pyrrolidone (NMP) compared to tetrahydrofuran, which may reflect easier CO dissociation from 1e−-reduced [M(CO)4(bpy)].− in the former solvent, followed by second electron transfer. The catalytic cycle may also involve [M(CO)4(H-bpy)]− formed by protonation of [M(CO)3(bpy)]2−, especially in NMP. The strongly enhanced catalysis using an Au working electrode is remarkable, suggesting that surface interactions may play an important role, too.
From Rational Design of Drug Crystals to Understanding of Nucleic Acid Structures: Lamivudine Duplex
Resumo:
A DNA-like duplex of nucleosides is probable to exist even without the 5`-phosphate groups needed to assemble the chain backbone. However, double-stranded helical structures of nucleosides are unknown. Here, we report a duplex of nucleoside analogs that is spontaneously assembled due to stacking of the neutral and protonated molecules of lamivudine, a nucleoside reverse transcriptase inhibitor (NTRI) widely used in anti-HIV drug combinatory medication. The left-handed lamivudine duplex has features similar to those of i-motif DNA, as the face-to-face base stacking and the helix rise per base pair. Furthermore, the protonation pattern on alternate bases expected for it DNA-like duplex stabilized by pairing of neutral and protonated cytosine fragments was observed for the first time in the lamivudine double-stranded helix. This structure demonstrates that hydrogen bonds can substitute for covalent phosphodiester linkage in the stabilization of the duplex backbone. This interesting example of spontaneous molecular self-organization indicates that the 5`-phosphate group could not be a requirement for duplex assembly.
Resumo:
The structural stability of a peroxidase, a dimeric protein from royal palm tree (Roystonea regia) leaves, has been characterized by high-sensitivity differential scanning calorimetry, circular dichroism, steady-state tryptophan fluorescence and analytical ultracentifugation under different solvent conditions. It is shown that the thermal and chemical (using guanidine hydrochloride (Gdn-HCl)) folding/unfolding of royal palm tree peroxidase (RPTP) at pH 7 is a reversible process involving a highly cooperative transition between the folded dimer and unfolded monomers, with a free stabilization energy of about 23 kcal per mol of monomer at 25 degrees C. The structural stability of RPTP is pH-dependent. At pH 3, where ion pairs have disappeared due to protonation, the thermally induced denaturation of RPTP is irreversible and strongly dependent upon the scan rate, suggesting that this process is under kinetic control. Moreover, thermally induced transitions at this pH value are dependent on the protein concentration, allowing it to be concluded that in solution RPTP behaves as dimer, which undergoes thermal denaturation coupled with dissociation. Analysis of the kinetic parameters of RPTP denaturation at pH 3 was accomplished on the basis of the simple kinetic scheme N ->(k) D, where k is a first-order kinetic constant that changes with temperature, as given by the Arrhenius equation; N is the native state, and D is the denatured state, and thermodynamic information was obtained by extrapolation of the kinetic transition parameters to an infinite heating rate. Obtained in this way, the value of RPTP stability at 25 degrees C is ca. 8 kcal per mole of monomer lower than at pH 7. In all probability, this quantity reflects the contribution of ion pair interactions to the structural stability of RPTP. From a comparison of the stability of RPTP with other plant peroxidases it is proposed that one of the main factors responsible for the unusually high stability of RPTP which enhances its potential use for biotechnological purposes, is its dimerization. (c) 2008 Elsevier Masson SAS. All rights reserved.
Resumo:
In the present study, the mycosporine-like amino acids (MAAs) were isolated from the marine red alga Gracilaria tenuistipitata and analysed by high-resolution accurate-mass sequential mass spectrometry (MSn). In addition to the proposed fragmentation mechanism based on the MSn analysis, it is clearly demonstrated that the elimination of mass 15 is a radical processes taking place at the methoxyl substituent of the double bond. This characteristic loss of a methyl radical was studied by theoretical calculations and the homolytic cleavage of the O-C bond is suggested to be dependent on the bond weakening. The protonation site of the MAAs was indicated by analysis of the Fukui functions and the relative Gibbs energies of the several possible protonated forms. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
N-Benzyl- and N-(alpha-methoxycarbonylethyl)-2,4,6-triphenyl-1,2-dihydropyridines were submitted to Diels-Alder reactions with maleic anhydride or N-phenylmaleimide yielding, diastereoselectively, the corresponding endo-anti adducts. These novel isoquinuclidines showed to be resistant to N-alkylation or N-protonation, undergoing an unexpected fragmentation via a retro aza Diels-Alder process.
Resumo:
The protonation effect on the vibrational and electronic spectra of 4-aminoazobenzene and 4-(dimethylamino)azobenzene was investigated by resonance Raman spectroscopy, and the results were discussed on the basis of quantum-chemical calculations. Although this class of molecular systems has been investigated in the past concerning the azo-hydrazone tautomerism, the present work is the first to use CASSCF/CASPT2 calculations to unveil the structure of both tautomers as well the nature of the molecular orbitals involved in chromophoric moieties responsible for the resonance Raman enhancement patterns. More specifically both the resonance Raman and theoretical results show clearly that in the neutral species, the charge transfer transition involves mainly the azo moiety, whereas in the protonated forms there is a great difference, depending on the tautomer. In fact, for the azo tautomer the transition is similar to that observed in the corresponding neutral species, whereas in the hydrazone tautomer such a transition is much more delocalized due to the contribution of the quinoid structure. The characterization of protonated species and the understanding of the tautomerization mechanism are crucial for controlling molecular properties depending on the polarity and pH of the medium.
Resumo:
Poly(ortho-phenylenediamine) and oligomers of ortho-phenylenediamine were chemically synthesized and characterized by UV-vis, (1)H and (13)C NMR, FTIR and resonance Raman spectroscopies. Polymerization of ortho-phenylenediamine in HCl medium with ammonium persulfate only leads the trimer compound, in disagreement with some previous reports. Nevertheless, in acetic acid medium it was possible to prepare a polymer constituted by ladder phenazinic segments with different protonation levels and quinonediimine rings (polyaniline-like). X-ray absorption at N K-edge (N K XANES), X-ray photoelectron (XPS) and Electron paramagnetic resonance (EPR) spectroscopies were used to determine the different kinds of nitrogen presents in this class of polymer. N K XANES spectrum of poly(ortho-phenylenediamine) shows the band of -N=nitrogen of non-protonated phenazinic rings at 398.2 eV. In addition, XPS and N K XANES data confirm the presence of different types of protonated nitrogens in the polymeric poly(ortho-phenylenediamine) chain and the EPR spectrum shows that the polymer has a very weak polaronic signal. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Tetra-alkoxysilanes are common and useful reagents in sol-gel processes and understanding their reactivity is important in the design of new materials. The mechanism of gas-phase reactions that mimic alcoholyis of Si(OMe)(4) (usually known as TMOS) under acidic conditions have been studied by Fourier transform ion cyclotron resonance techniques and density functional calculations at the B3LYP/6-311+G(d,p) level. The proton affinity of TMOS has been estimated at 836.4 kJ mol(-1) and protonation of TMOS gives rise to an ionic species that is best represented as trimethoxysilyl cations associated with a methanol molecule. Protonated TMOS undergoes rapid and sequential substitution of the methoxy groups in the gas-phase upon reaction with alcohols. The calculated energy profile of the reaction indicates that the substitution reaction through an S(N)2 type mechanism may be more favorable than frontal attack at silicon. Furthermore, the sequential substitution reactions are promoted by a mechanism that involves proton shuttle from the most favorable protonation site to the oxygen of the departing group mediated by the neutral reagent molecule.
Resumo:
The influence of molecular oxygen in the interactions of emeraldine base form of polyaniline (EB-PANI) with Fe(III) or Cu(II) ions in 1-methyl-2-pyrrolidinone (NMP) solutions has been investigated by UV-vis-NIR, resonance Raman and electron paramagnetic resonance (EPR) spectroscopies. Through the set of spectroscopic results it was possible to rationalize the role Of O(2) and to construct a scheme of preferential routes occurring in the interaction of EB-PANI with Fe(III) or Cu(II). Solutions of 4.0 mmol L(-1) EB-PANI with 0.8, 2.0 and 20 mmol L(-1) Fe(III) or Cu(II) ions in NMP were investigated and the main observed reactions were EB-PANI oxidation to pernigraniline (PB-PANI) and EB-PANI doping process by pseudo-protonation, or by a two-step redox process. In the presence Of O(2), PB-PANI is observed in all Fe(III)/EB solutions and EB-PANI doping only occurs in solutions with high Fe(III) concentrations through pseudo-protonation. On the other hand, emeraldine salt (ES-PANI) is formed in all Fe(III)/EB solutions under N(2) atmosphere and, in this case, doping occurs both by the pseudo-protonation and two-step redox mechanisms. In all Cu(II)/EB solutions PB-PANI is formed both in the presence and absence of O(2), and only for solutions with high Cu(II) concentrations doping process occurs in a very low degree. The most important result from EPR spectra was providing evidence for redox steps. The determined Cu(II) signal areas under oxygen are higher than under N(2) and, further. the initial metal proportions (1:2:20) are maintained in these spectra, indicating that Cu(I) formed are re-oxidized by O(2) and. so, Cu(II) ions are being recycled. Consistently, for the solutions prepared under nitrogen, the corresponding areas and proportions in the spectra are much lower, confirming that a partial reduction of Cu(II) ions actually occurs. (C) 2009 Elsevier B.V. All rights reserved.