A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Selective inhibition of the platelet-derived growth factor signal transduction pathway by a protein-tyrosine kinase inhibitor of the 2-phenylaminopyrimidine class.

The platelet-derived growth factor (PDGF) receptor is a member of the transmembrane growth factor receptor protein family with intrinsic protein-tyrosine kinase activity. We describe a potent protein-tyrosine kinase inhibitor (CGP 53716) that shows selectivity for the PDGF receptor in vitro and in the cell. The compound shows selectivity for inhibition of PDGF-mediated events such as PDGF receptor autophosphorylation, cellular tyrosine phosphorylation, and c-fos mRNA induction in response to PDGF stimulation of intact cells. In contrast, ligand-induced autophosphorylation of the epidermal growth factor (EGF) receptor, insulin receptor, and the insulin-like growth factor I receptor, as well as c-fos mRNA expression induced by EGF, fibroblast growth factor, and phorbol ester, was insensitive to inhibition by CGP 53716. In antiproliferative assays, the compound was approximately 30-fold more potent in inhibiting PDGF-mediated growth of v-sis-transformed BALB/c 3T3 cells relative to inhibition of EGF-dependent BALB/Mk cells, interleukin-3-dependent FDC-P1 cells, and the T24 bladder carcinoma line. When tested in vivo using highly tumorigenic v-sis- and human c-sis-transformed BALB/c 3T3 cells, CGP 53716 showed antitumor activity at well-tolerated doses. In contrast, CGP 53716 did not show antitumor activity against xenografts of the A431 tumor, which overexpresses the EGF receptor. These findings suggest that CGP 53716 may have therapeutic potential for the treatment of diseases involving abnormal cellular proliferation induced by PDGF receptor activation.

Factor VIII deficiency inhibition or abnormal contact

Poster presented at the International Society on Thrombosis and Haemostasis 2015 Congress, 20-25 June 2015, Toronto.

A macrophage colony-stimulating factor receptor-green fluorescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse

The c-fms gene encodes the receptor for macrophage colony-stimulating factor (CSF-1). The gene is expressed selectively in the macrophage and trophoblast cell lineages. Previous studies have indicated that sequences in intron 2 control transcript elongation in tissue-specific and regulated expression of c-fms. In humans, an alternative promoter was implicated in expression of the gene in trophoblasts. We show that in mice, c-fms transcripts in trophoblasts initiate from multiple points within the 2-kilobase (kb) region flanking the first coding exon. A reporter gene construct containing 3.5 kb of 5' flanking sequence and the down-stream intron 2 directed expression of enhanced green fluorescent protein (EGFP) to both trophoblasts and macrophages. EGFP was detected in trophoblasts from the earliest stage of implantation examined at embryonic day 7.5. During embryonic development, EGFP highlighted the large numbers of c-fms-positive macrophages, including those that originate from the yolk sac. In adult mice, EGFP location Was consistent with known F4/80-positive macrophage populations, including Langerhans cells of the skin, and permitted convenient sorting of isolated tissue macrophages from disaggregated tissue. Expression of EGFP in transgenic mice was dependent on intron 2 as no lines with detectable EGFP expression were obtained where either all of intron 2 or a conserved enhancer element FIRE (the Fms intronic regulatory element) was removed. We have therefore defined the elements required to generate myeloid- and trophoblast-specific transgenes as well as a model system for the study of mononuclear phagocyte development and function. (C) 2003 by The American Society of Hematology.

Inhibition of epidermal growth factor receptor expression by RNA interference in A549 cells

AIM: To investigate the biological features of A549 cells in which epidermal growth factor (EGF) receptors expression were suppressed by RNA interference (RNAi). METHODS: A549 cells were transfected using short small interfering RNAs (siRNAs) formulated with Lipofectamine 2000. The EGF receptor numbers were determined by Western blotting and flowcytometry. The antiproliferative effects of sequence specific double stranded RNA (dsRNA) were assessed using cell count, colony assay and scratch assay. The chemosensitivity of transfected cells to cisplatin was measured by MTT. RESULTS: Sequence specific dsRNA-EGFR down-regulated EGF receptor expression dramatically. Compared with the control group, dsRNA-EGFR reduced the cell number by 85.0 %, decreased the colonies by 63.3 %, inhibited the migration by 87.2 %, and increased the sensitivity of A549 to cisplatin by four-fold. CONCLUSION: Sequence specific dsRNA-EGFR were capable of suppressing EGF receptor expression, hence significantly inhibiting cellular proliferation and motility, and enhancing chemosensitivity of A549 cells to cisplatin. The successful application of dsRNA-EGFR for inhibition of proliferation in EGF receptor overexpressing cells can help extend the list of available therapeutic modalities in the treatment of non-small-cell lung carcinoma (NSCLC).

Inhibition of transforming growth factor-beta 1 signaling attenuates ataxia telanglectasia mutated activity in response to genotoxic stress

Ionizing radiation causes DNA damage that elicits a cellular program of damage control coordinated by the kinase activity of ataxia telangiectasia mutated protein (ATM). Transforming growth factor beta (TGF beta)-1, which is activated by radiation, is a potent and pleiotropic mediator of physiologic and pathologic processes. Here we show that TGF beta inhibition impedes the canonical cellular DNA damage stress response. Irradiated Tgf beta 1 nail murine epithelial cells or human epithelial cells treated with a small-molecule inhibitor of TGF beta type I receptor kinase exhibit decreased phosphorylation of Chk2, Rad17, and p53; reduced gamma H2AX radiation-induced foci; and increased radiosensitivity compared with TGF beta competent cells. We determined that loss of TGF beta signaling in epithelial cells truncated ATM autophosphorylation and significantly reduced its kinase activity, without affecting protein abundance. Addition of TGF beta restored functional ATM and downstream DNA damage responses. These data reveal a heretofore undetected critical link between the microenvironment and ATM, which directs epithelial cell stress responses, cell fate, and tissue integrity. Thus, Tgf beta 1, in addition to its role in homoeostatic growth control, plays a complex role in regulating responses to genotoxic stress, the failure of which would contribute to the development of cancer; conversely, inhibiting TGF beta may be used to advantage in cancer therapy.

Induction of apoptosis by a cachectic-factor in murine myotubes and inhibition by eicosapentaenoic acid

Treatment of C2C12 myotubes with a tumour-derived proteolysis-inducing factor (PIF) at concentrations between 1 and 10 nM was shown to stimulate the activity of the apoptotic initiator caspases-8 and -9 and the apoptotic effector caspases-2,-3 and -6. This increased caspase activity was attenuated in myotubes pretreated with 50 μM eicosapentaenoic acid (EPA). At least part of the increase in caspase activity may be related to the increased proteasome proteolytic activity, since a caspase-3 inhibitor completely attenuated the PIF-induced increase in 'chymotrypsin-like' enzyme activity, the predominant proteolytic activity of the proteasome. However, Western blot analysis showed that PIF induced an increase in expression of the active form of caspase-3, which was also attenuated by EPA. Further Western blot analysis showed PIF increased the cytosolic content of cytochrome c, as well as expression of the pro-apoptotic protein bax but not the antiapoptotic protein bcl-2, which were both attenuated by 50 μM EPA. Induction of apoptosis by PIF in murine myotubes was confirmed by an increase in free nucleasomes formation and increased DNA fragmentation evidenced by a nucleasomal ladder typical of apoptotic cells. This process was again inhibited by pre-incubation with EPA. These results suggest that in addition to activating the proteasome, PIF induces apoptosis in C2C12 myotubes, possibly through the common intermediate arachidonic acid. Both of these processes would contribute to the loss of skeletal muscle in cancer cachexia.

Macrophage migration inhibitory factor (MIF) family in arthropods : cloning and expression analysis of two MIF and one D-dopachrome tautomerase (DDT) homologues in Mud crabs, Scylla paramamosain

5. Acknowledgements This research was supported by grants from the National Natural Science Foundation of China (Nos. 31172438 and U1205123), the Natural Science Foundation of Fujian Province (No. 2012J06008 and 201311180002) and the projects-sponsored by SRF. TW received funding from the MASTS pooling initiative (The Marine Alliance for Science and Technology for Scotland) funded by the Scottish Funding Council (grant reference HR09011) and contributing institutions.

Suppression of nuclear factor-κB activity in macrophages by chylomicron remnants: modulation by the fatty acid composition of the particles

Current evidence indicates that chylomicron remnants (CMR) induce macrophage foam cell formation, an early event in atherosclerosis. Inflammation also plays a part in atherogenesis and the transcription factor nuclear factor-kappaB (NF-kappaB) has been implicated. In this study, the influence of CMR on the activity of NF-kappaB in macrophages and its modulation by the fatty acid composition of the particles were investigated using macrophages derived from the human monocyte cell line THP-1 and CMR-like particles (CRLPs). Incubation of THP-1 macrophages with CRLPs caused decreased NF-kappaB activation and downregulated the expression of phospho-p65-NF-kappaB and phospho-IkappaBalpha (pIkappaBalpha). Secretion of the inflammatory cytokines tumour necrosis factor alpha, interleukin-6 and monocyte chemoattractant protein-1, which are under NF-kappaB transcriptional control, was inhibited and mRNA expression for cyclooxygenase-2, an NF-kappaB target gene, was reduced. CRLPs enriched in polyunsaturated fatty acids compared with saturated or monounsaturated fatty acids had a markedly greater inhibitory effect on NF-kappaB binding to DNA and the expression of phospho-p65-NF-kappaB and pIkappaB. Lipid loading of macrophages with CRLPs enriched in polyunsaturated fatty acids compared with monounsaturated fatty acids or saturated fatty acids also increased the subsequent rate of cholesterol efflux, an effect which may be linked to the inhibition of NF-kappaB activity. These findings demonstrate that CMR suppress NF-kappaB activity in macrophages, and that this effect is modulated by their fatty acid composition. This downregulation of inflammatory processes in macrophages may represent a protective effect of CMR which is enhanced by dietary polyunsaturated fatty acids.

TRIB2 in normal and malignant hematopoiesis - a transcription factor network

Hematopoiesis is the tightly controlled and complex process in which the entire blood system is formed and maintained by a rare pool of hematopoietic stem cells (HSCs), and its dysregulation results in the formation of leukaemia. TRIB2, a member of the Tribbles family of serine/threonine pseudokinases, has been implicated in a variety of cancers and is a potent murine oncogene that induces acute myeloid leukaemia (AML) in vivo via modulation of the essential myeloid transcription factor CCAAT-enhancer binding protein α (C/EBPα). C/EBPα, which is crucial for myeloid cell differentiation, is commonly dysregulated in a variety of cancers, including AML. Two isoforms of C/EBPα exist - the full-length p42 isoform, and the truncated oncogenic p30 isoform. TRIB2 has been shown to selectively degrade the p42 isoform of C/EBPα and induce p30 expression in AML. In this study, overexpression of the p30 isoform in a bone marrow transplant (BMT) leads to perturbation of myelopoiesis, and in the presence of physiological levels of p42, this oncogene exhibited weak transformative ability. It was also shown by BMT that despite their degradative relationship, expression of C/EBPα was essential for TRIB2 mediated leukaemia. A conditional mouse model was used to demonstrate that oncogenic p30 cooperates with TRIB2 to reduce disease latency, only in the presence of p42. At the molecular level, a ubiquitination assay was used to show that TRIB2 degrades p42 by K48-mediated proteasomal ubiquitination and was unable to ubiquitinate p30. Mutation of a critical lysine residue in the C-terminus of C/EBPα abrogated TRIB2 mediated C/EBPα ubiquitination suggesting that this site, which is frequently mutated in AML, is the site at which TRIB2 mediates its degradative effects. The TRIB2-C/EBPα axis was effectively targeted by proteasome inhibition. AML is a very difficult disease to target therapeutically due to the extensive array of chromosomal translocations and genetic aberrations that contribute to the disease. The cell from which a specific leukaemia arises, or leukaemia initiating cell (LIC), can affect the phenotype and chemotherapeutic response of the resultant disease. The LIC has been elucidated for some common oncogenes but it is unknown for TRIB2. The data presented in this thesis investigate the ability of the oncogene TRIB2 to transform hematopoietic stem and progenitor cells in vitro and in vivo. TRIB2 overexpression conferred in vitro serially replating ability to all stem and progenitor cells studied. Upon transplantation, only TRIB2 overexpressing HSCs and granulocyte/macrophage progenitors (GMPs) resulted in the generation of leukaemia in vivo. TRIB2 induced a mature myeloid leukaemia from the GMP, and a mixed lineage leukaemia from the HSC. As such the role of TRIB2 in steady state hematopoiesis was also explored using a Trib2-/- mouse and it was determined that loss of Trib2 had no effect on lineage distribution in the hematopoietic compartment under steady-state conditions. The process of hematopoiesis is controlled by a host of lineage restricted transcription factors. Recently members of the Nuclear Factor 1 family of transcription factors (NFIA, NFIB, NFIC and NFIX) have been implicated in hematopoiesis. Little is known about the role of NFIX in lineage determination. Here we describe a novel role for NFIX in lineage fate determination. In human and murine datasets the expression of Nfix was shown to decrease as cells differentiated along the lymphoid pathway. NFIX overexpression resulted in enhanced myelopoiesis in vivo and in vitro and a block in B cell development at the pre-pro-B cell stage. Loss of NFIX resulted in disruption of myeloid and lymphoid differentiation in vivo. These effects on stem and progenitor cell fate correlated with changes in the expression levels of key transcription factors involved in hematopoietic differentiation including a 15-fold increase in Cebpa expression in Nfix overexpressing cells. The data presented support a role for NFIX as an important transcription factor influencing hematopoietic lineage specification. The identification of NFIX as a novel transcription factor influencing lineage determination will lead to further study of its role in hematopoiesis, and contribute to a better understanding of the process of differentiation. Elucidating the relationship between TRIB2 and C/EBPα not only impacts on our understanding of the pathophysiology of AML but is also relevant in other cancer types including lung and liver cancer. Thus in summary, the data presented in this thesis provide important insights into key areas which will facilitate the development of future therapeutic approaches in cancer treatment.

Co-administration of plasmid-encoded granulocyte-macrophage colony-stimulating factor increases human immunodeficiency virus-1 DNA vaccine-induced polyfunctional CD4+ T-cell responses

T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+ T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.