984 resultados para Macrophage Activation
Resumo:
Human granulocyte-macrophage colony-stimulating factor (hGM-CSF) induces proliferation and sustains the viability of the mouse interleukin-3-dependent cell line BA/F3 expressing the hGM-CSF receptor. Analysis of the antiapoptosis activity of GM-CSF receptor βc mutants showed that box1 but not the C-terminal region containing tyrosine residues is essential for GM-CSF-dependent antiapoptotic activity. Because βc mutants, which activate Janus kinase 2 but neither signal transducer and activator of transcription 5 nor the MAPK cascade sustain antiapoptosis activity, involvement of Janus kinase 2, excluding the above molecules, in antiapoptosis activity seems likely. GM-CSF activates phosphoinositide-3-OH kinase as well as Akt, and activation of both was suppressed by addition of wortmannin. Interestingly, wortmannin did not affect GM-CSF-dependent antiapoptosis, thus indicating that the phosphoinositide-3-OH kinase pathway is not essential for cell surivival. Analysis using the tyrosine kinase inhibitor genistein and a MAPK/extracellular signal-regulated kinase (ERK) kinase 1 inhibitor, PD98059, indicates that activation of either the genistein-sensitive signaling pathway or the PD98059-sensitive signaling pathway from βc may be sufficient to suppress apoptosis. Wild-type and a βc mutant lacking tyrosine residues can induce expression of c-myc and bcl-xL genes; however, drug sensitivities for activation of these genes differ from those for antiapoptosis activity of GM-CSF, which means that these gene products may be involved yet are inadequate to promote cell survival.
Resumo:
Many cytokines exert their biological effect through members of the hemopoietin receptor family. Using degenerate oligonucleotides to the common WSXWS motif, we have cloned from human hemopoietic cell cDNA libraries various forms of the receptor that was recently shown to bind the obesity hormone, leptin. mRNAs encoding long and short forms of the human leptin receptor were found to be coexpressed in a range of human and murine hemopoietic organs, and a subset of cells from these tissues bound leptin at the cell surface. Ectopic expression in murine Ba/F3 and M1 cell lines revealed that the long, but not the short, form of the leptin receptor can signal proliferation and differentiation, respectively. In cultures of murine or human marrow cells, human leptin exhibited no capacity to stimulate cell survival or proliferation, but it enhanced cytokine production and phagocytosis of Leishmania parasites by murine peritoneal macrophages. Our data provide evidence that, in addition to its role in fat regulation, leptin may also be able to regulate aspects of hemopoiesis and macrophage function.
Resumo:
IFNγ, once called the macrophage-activating factor, stimulates many genes in macrophages, ultimately leading to the elicitation of innate immunity. IFNγ's functions depend on the activation of STAT1, which stimulates transcription of IFNγ-inducible genes through the GAS element. The IFN consensus sequence binding protein (icsbγ or IFN regulatory factor 8), encoding a transcription factor of the IFN regulatory factor family, is one of such IFNγ-inducible genes in macrophages. We found that macrophages from ICSBP−/− mice were defective in inducing some IFNγ-responsive genes, even though they were capable of activating STAT1 in response to IFNγ. Accordingly, IFNγ activation of luciferase reporters fused to the GAS element was severely impaired in ICSBP−/− macrophages, but transfection of ICSBP resulted in marked stimulation of these reporters. Consistent with its role in activating IFNγ-responsive promoters, ICSBP stimulated reporter activity in a GAS-specific manner, even in the absence of IFNγ treatment, and in STAT1 negative cells. Indicative of a mechanism for this stimulation, DNA affinity binding assays revealed that endogenous ICSBP was recruited to a multiprotein complex that bound to GAS. These results suggest that ICSBP, when induced by IFNγ through STAT1, in turn generates a second wave of transcription from GAS-containing promoters, thereby contributing to the elicitation of IFNγ's unique activities in immune cells.
Resumo:
Recently, Salmonella spp. were shown to induce apoptosis in infected macrophages. The mechanism responsible for this process is unknown. In this report, we establish that the Inv-Spa type III secretion apparatus target invasin SipB is necessary and sufficient for the induction of apoptosis. Purified SipB microinjected into macrophages led to cell death. Binding studies show that SipB associates with the proapoptotic protease caspase-1. This interaction results in the activation of caspase-1, as seen in its proteolytic maturation and the processing of its substrate interleukin-1β. Caspase-1 activity is essential for the cytotoxicity. Functional inhibition of caspase-1 activity by acetyl-Tyr-Val-Ala-Asp-chloromethyl ketone blocks macrophage cytotoxicity, and macrophages lacking caspase-1 are not susceptible to Salmonella-induced apoptosis. Taken together, the data demonstrate that SipB functions as an analog of the Shigella invasin IpaB.
Resumo:
While effector molecules produced by activated macrophages (including nitric oxide, tumor necrosis factor α, interleukin 1, etc.) help to eliminate pathogens, high levels of these molecules can be deleterious to the host itself. Despite their importance, the mechanisms modulating macrophage effector functions are poorly understood. This work introduces two key negative regulators that control the levels and duration of macrophage cytokine production. Vacuolar-type H+-ATPase (V-ATPase) and calcineurin (Cn) constitutively act in normal macrophages to suppress expression of inflammatory cytokines in the absence of specific activation and to inhibit macrophage cytokine responses induced by bacterial lipopolysaccharide (V-ATPase), interferon γ (V-ATPase and Cn), and calcium (Ca2+) flux (Cn). Cn and V-ATPase modulate effector gene expression at the mRNA level by inhibiting transcription factor NF-κB. This negative regulation by Cn is opposite to its crucial positive role in T cells, where it activates NFAT transcription factor(s) leading to expression of interleukin 2, tumor necrosis factor α, and other cytokine genes. The negative effects of V-ATPase and Cn on NF-κB-dependent gene expression are not limited to the macrophage lineage, as similar effects have been seen with a murine fibroblast cell line and with primary astrocytes.
Resumo:
A bioactive macrophage factor, the polypeptide daintain/allograft inflammatory factor 1 (AIF1), has been isolated from porcine intestine. It was discovered when searching for intestinal peptides with effects on insulin release, and its purification was monitored by the influence of the peptide fractions on pancreatic glucose-induced insulin secretion. Daintain/AIF1 is a 146-aa residue polypeptide with a mass of 16,603 Da and an acetylated N terminus. An internal 44-residue segment with the sequence pattern –KR–KK–GKR– has a motif typical of peptide hormone precursors, i.e., dibasic sites for potential activation cleavages and at the sequentially last such site, the structure GKR. The latter is a signal for C-terminal amide formation in the processing of peptide hormones. Daintain/AIF1 is immunohistochemically localized to microglial cells in the central nervous system and to dendritic cells and macrophages in several organs. A particularly dense accumulation of daintain/AIF1-immunoreactive macrophages was observed in the insulitis affecting the pancreatic islets of prediabetic BB rats. When injected intravenously in mice, daintain/AIF1 at 75 pmol/kg inhibited glucose (1 g/kg)-stimulated insulin secretion, with a concomitant impairment of the glucose elimination, whereas at higher doses (7.5 and 75 nmol/kg), daintain/AIF1 potentiated glucose-stimulated insulin secretion and enhanced the glucose elimination. Its dual influence on insulin secretion in vivo at different peptide concentrations, and the abundance of macrophages expressing daintain/AIF1 in the pancreatic islets of prediabetic rats, suggest that daintain/AIF1 may have a role in connection with the pathogenesis of insulin-dependent diabetes mellitus.
Resumo:
An important component of cytokine regulation of cell growth and differentiation is rapid transcriptional activation of genes by the JAK-STAT (signal transducer and activator of transcription) signaling pathway. Ligation of cytokine receptors results in tyrosine phosphorylation and activation of receptor-associated Jak protein tyrosine kinases and cytoplasmic STAT transcription factors, which then translocate to the nucleus. We describe the interruption of cytokine triggered JAK-STAT signals by cAMP, the calcium ionophore ionomycin, and granulocyte/macrophage colony-stimulating factor. Jak1 kinase activity, interleukin 6-induced gene activation, Stat3 tyrosine phosphorylation, and DNA-binding were inhibited, as was activation of Jak1 and Stat1 by interferon gamma. The kinetics and requirement for new RNA and protein synthesis for inhibition of interleukin 6 by ionomycin and GM-CSF differed, but both agents increased the association of Jak1 with protein tyrosine phosphatase ID (SH2-containing phosphatase 2). Our results demonstrate that crosstalk with distinct signaling pathways can inhibit JAK-STAT signal transduction, and suggest approaches for modulating cytokine activity during immune responses and inflammatory processes.
Resumo:
The c-rel protooncogene encodes a subunit of the NF-kappa B-like family of transcription factors. Mice lacking Rel are defective in mitogenic activation of B and T lymphocytes and display impaired humoral immunity. In an attempt to identify changes in gene expression that accompany the T-cell stimulation defects associated with the loss of Rel, we have examined the expression of cell surface activation markers and cytokine production in mitogen-stimulated Rel-/- T cells. The expression of cell surface markers including the interleukin 2 receptor alpha (IL-2R alpha) chain (CD25), CD69 and L-selectin (CD62) is normal in mitogen-activated Rel-/- T cells, but cytokine production is impaired. In Rel-/- splenic T cell cultures stimulated with phorbol 12-myristate 13-acetate and ionomycin, the levels of IL-3, IL-5, granulocyte- macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-alpha), and gamma interferon (IFN-gamma) were only 2- to 3-fold lower compared with normal T cells. In contrast, anti-CD3 and anti-CD28 stimulated Rel-/- T cells, which fail to proliferate, make little or no detectable cytokines. Exogenous IL-2, which restitutes the proliferative response of the anti-CD3- and anti-CD28-treated Rel-/- T cells, restores production of IL-5, TNF-alpha, and IFN-gamma, but not IL-3 and GM-CSF expression to approximately normal levels. In contrast to mitogen-activated Rel-/- T cells, lipopolysaccharide-stimulated Rel-/- macrophages produce higher than normal levels of GM-CSF. These findings establish that Rel can function as an activator or repressor of gene expression and is required by T lymphocytes for production of IL-3 and GM-CSF.
Resumo:
Activation of macrophages by bacterial lipopolysaccharide (LPS) induces transcription of genes that encode for proinflammatory regulators of the immune response. Previous work has suggested that activation of the transcription factor activator protein 1 (AP-1) is one LPS-induced event that mediates this response. Consistent with this notion, we found that LPS stimulated AP-1-mediated transcription of a transfected reporter gene in the murine macrophage cell line RAW 264.7. As AP-1 activity is regulated in part by activation of the c-Jun N-terminal kinase (JNK), which phosphorylates and subsequently increases the transcriptional activity of c-Jun, we examined whether LPS treatment of macrophages resulted in activation of this kinase. LPS treatment of RAW 264.7 cells, murine bone marrow-derived macrophages, and the human monocyte cell line THP-1 resulted in rapid activation of the p46 and p54 isoforms of JNK. Treatment with wild-type and rough mutant forms of LPS and synthetic lipid A resulted in JNK activation, while pretreatment with the tyrosine kinase inhibitor herbimycin A inhibited this response. Binding of LPS-LPS binding protein (LBP) complexes to CD14, a surface receptor that mediates many LPS responses, was found to be crucial, as pretreatment of THP-1 cells with the monoclonal antibody 60b, which blocks this binding, inhibited JNK activation. These results suggest that LPS activation of JNK in monocyte/macrophage cells is a CD14- and protein tyrosine phosphorylation-dependent event that may mediate the early activation of AP-1 in regulating LPS-triggered gene induction.
Resumo:
The (3;21)(q26;q22) translocation associated with treatment-related myelodysplastic syndrome, treatment-related acute myeloid leukemia, and blast crisis of chronic myeloid leukemia results in the expression of the chimeric genes AML1/EAP, AML1/MDS1, and AML1/EVI1. AML1 (CBFA2), which codes for the alpha subunit of the heterodimeric transcription factor CBF, is also involved in the t(8;21), and the gene coding for the beta subunit (CBFB) is involved in the inv(16). These are two of the most common recurring chromosomal rearrangements in acute myeloid leukemia. CBF corresponds to the murine Pebp2 factor, and CBF binding sites are found in a number of eukaryotic and viral enhancers and promoters. We studied the effects of AML1/EAP and AML1/MDS1 at the AML1 binding site of the CSF1R (macrophage-colony-stimulating factor receptor gene) promoter by using reporter gene assays, and we analyzed the consequences of the expression of both chimeric proteins in an embryonic rat fibroblast cell line (Rat1A) in culture and after injection into athymic nude mice. Unlike AML1, which is an activator of the CSF1R promoter, the chimeric proteins did not transactivate the CSF1R promoter site but acted as inhibitors of AML1 (CBFA2). AML1/EAP and AML1/MDS1 expressed in adherent Rat1A cells decreased contact inhibition of growth, and expression of AML1/MDS1 was associated with acquisition of the ability to grow in suspension culture. Expression of AML1/MDS1 increased the tumorigenicity of Rat1A cells injected into athymic nude mice, whereas AML1/EAP expression prevented tumor growth. These results suggest that expression of AML1/EAP and AML1/MDS1 can interfere with normal AML1 function, and that AML1/MDS1 has tumor-promoting properties in an embryonic rat fibroblast cell line.
Resumo:
Nitric oxide (NO) has been implicated as a pathogenic mediator in a variety of central nervous system (CNS) disease states, including the animal model of multiple sclerosis (MS) and experimental allergic encephalomyelitis. We have examined post-mortem brain tissues collected from patients previously diagnosed with MS, as well as tissues collected from the brains of patients dying without neuropathies. Both Northern blot analysis and reverse transcriptase (RT)-driven in situ PCR (RT-in situ PCR) studies demonstrated that inducible NO synthase (iNOS) mRNA was present in the brain tissues from MS patients but was absent in equivalent tissues from normal controls. We have also performed experiments identifying the cell type responsible for iNOS expression by RT-in situ PCR in combination with immunohistochemistry. Concomitantly, we analyzed the tissues for the presence of the NO reaction product nitrotyrosine to demonstrate the presence of a protein nitrosylation adduct. We report here that iNOS mRNA was detectable in the brains of 100% of the CNS tissues from seven MS patients examined but in none of the three normal brains. RT-in situ PCR experiments also demonstrated the presence of iNOS mRNA in the cytoplasm of cells that also expressed the ligand recognized by the Ricinus communis agglutinin 1 (RCA-1), a monocyte/macrophage lineage marker. Additionally, specific labeling of cells was observed when brain tissues from MS patients were exposed to antisera reactive with nitrotyrosine residues but was significantly less plentiful in brain tissue from patients without CNS disease. These results demonstrate that iNOS, one of the enzymes responsible for the production of NO, is expressed at significant levels in the brains of patients with MS and may contribute to the pathology associated with the disease.
Resumo:
Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The cellular changes during ageing are incompletely understood yet immune system dysfunction is implicated in the age-related decline in health. The acquired immune system shows a functional decline in ability to respond to new pathogens whereas serum levels of cytokines are elevated with age. Despite these age-associated increases in circulating cytokines, the function of aged macrophages is decreased. Pathogen-associated molecular pattern receptors such as Toll-like receptors (TLRs) are vital in the response of macrophages to pathological stimuli. Here we review the evidence for defective TLR signalling in normal ageing. Gene transcription, protein expression and cell surface expression of members of the TLR family of receptors and co-effector molecules do not show a consistent age-dependent change across model systems. However, there is evidence for impaired downstream signalling events, including inhibition of positive and activation of negative modulators of TLR induced signalling events. In this paper we hypothesize that despite a poor inflammatory response via TLR activation, the ineffective clearance of pathogens by macrophages increases the duration of their activation and contributes to perpetuation of inflammatory responses and ageing.
Resumo:
Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen. Several antibiotic resistant strains of P. aeruginosa are commonly found as secondary infection in immune-compromised patients leaving significant mortality and healthcare cost. Pseudomonas aeruginosa successfully avoids the process of phagocytosis, the first line of host defense, by secreting several toxic effectors. Effectors produced from P. aeruginosa Type III secretion system are critical molecules required to disrupt mammalian cell signaling and holds particular interest to the scientists studying host-pathogen interaction. Exoenzyme S (ExoS) is a bi-functional Type III effector that ADP-ribosylates several intracellular Ras (Rat sarcoma) and Rab (Response to abscisic acid) small GTPases in targeted host cells. The Rab5 protein acts as a rate limiting protein during phagocytosis by switching from a GDP- bound inactive form to a GTP-bound active form. Activation and inactivation of Rab5 protein is regulated by several Rab5-GAPs (GTPase Activating Proteins) and Rab5-GEFs (Rab5-Guanine nucleotide Exchange Factors). Some pathogenic bacteria have shown affinity for Rab proteins during infection and make their way inside the cell. This dissertation demonstrated that Rab5 plays a critical role during early steps of P. aeruginosa invasion in J774-Eclone macrophages. It was found that live, but not heat inactivated, P. aeruginosa inhibited phagocytosis that occurred in conjunction with down-regulation of Rab5 activity. Inactivation of Rab5 was dependent on ExoS ADP-ribosyltransferase activity, and more than one arginine sites in Rab5 are possible targets for ADP-ribosylation modification. However, the expression of Rin1, but not other Rab5GEFs (Rabex-5 and Rap6) reversed this down-regulation of Rab5 in vivo. Further studies revealed that the C-terminus of Rin1 carrying Rin1:Vps9 and Rin1:RA domains are required for optimal Rab5 activation in conjunction with active Ras. These observations demonstrate a novel mechanism of Rab5 targeting to phagosome via Rin1 during the phagocytosis of P. aeruginosa. The second part of this dissertation investigated antimicrobial activities of Dehydroleucodine (DhL), a secondary metabolite from Artemisia douglasiana, against P. aeruginosa growth and virulence. Populations of several P. aeruginosa strains were completely susceptible to DhL at a concentration between 0.48~0.96 mg/ml and treatment at a threshold concentration (0.12 mg/ml) inhibited growth and many virulent activities without damaging the integrity of the cell suggesting anti-Pseudomonas activity of DhL.