997 resultados para Inter-chromosomal trans-splicing


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

High performance video codec is mandatory for multimedia applications such as video-on-demand and video conferencing. Recent research has proposed numerous video coding techniques to meet the requirement in bandwidth, delay, loss and Quality-of-Service (QoS). In this paper, we present our investigations on inter-subband self-similarity within the wavelet-decomposed video frames using neural networks, and study the performance of applying the spatial network model to all video frames over time. The goal of our proposed method is to restore the highest perceptual quality for video transmitted over a highly congested network. Our contributions in this paper are: (1) A new coding model with neural network based, inter-subband redundancy (ISR) prediction for video coding using wavelet (2) The performance of 1D and 2D ISR prediction, including multiple levels of wavelet decompositions. Our result shows a short-term quality enhancement may be obtained using both 1D and 2D ISR prediction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The crystal structures of a pair of closely related macrocyclic cyano- and hydroxopentaaminecobalt(III) complexes, as their perchlorate salts, are reported. Although the two complexes, [Co(CN)(C11H27N5)](ClO4)2.H2O and [Co(OH)(C11H27N5)](ClO4)(2), exhibit similar conformations, significant differences in the Co-N bond lengths arise from the influence of the sixth ligand (cyano as opposed to hydroxo). The ensuing hydrogen-bonding patterns are also distinctly different. Disorder in the perchlorate anions was clearly resolved and this was rationalized on the basis of distinct hydrogen-bonding motifs involving the anion O atoms and the N-H and O-H donors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

p53 is known to repress transcription of a number of genes, but the mechanism of p53 recruitment to these target genes is unknown. The c-myb proto-oncogene product (c-Myb) positively regulates proliferation of immature hematopoietic cells, whereas p53 blocks cell cycle progression. Here, we demonstrate that p53 inhibits c-Myb-induced transcription and transformation by directly binding to c-Myb. The ability of c-Myb to maintain the undifferentiated state of M1 cells was also suppressed by p53. p53 did not affect the ability of c-Myb to bind to DNA but formed a ternary complex with the corepressor mSin3A and c-Myb. Thus, p53 antagonizes c-Myb by recruiting mSin3A to down-regulate specific Myb target genes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The trans-[RUCl(2)(L)(4)], trans-[Ru(NO)Cl (L)(4)](PF(6))(2) (L = isonicotinamide and 4-acetylpyridine) and trans-[Ru(NO)(OH)(py)(4)]Cl(2) (py = pyridine) complexes have been prepared and characterized by elemental analysis, UV-visible, infrared, and (1)H NMR spectroscopies, and cyclic voltammetry. The MLCT band energies of trans-[RUCl(2)(L)(4) increase in the order 4-acpy < isn < py. The reduction potentials of trans-[RuCl(2)(L)(4)] and trans-[Ru(NO)Cl(L)(4)](2+) increase in the order py < isn < 4-acpy. The stretching band frequency. v(NO), of the nitrosyl complexes ranges from 1913 to 1852 cm(-1) indicating a nitrosonium character for the NO ligand. Due to the large pi-acceptor ability of the equatorial ligands, the coordinated water is much more acidic in the water soluble trans-[Ru(NO)(H(2)O)(py)(4)](3+) than in trans-[Ru(NO)(H(2)O)(NH(3))(4)](3+) (C) 2009 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stibadocerina Alexander, a monotypic genus, includes the only known Neotropical species of the family Cylindrotomidae, S. chilensis Alexander, 1929, from South Central Chile (ca. 36 degrees 50`S-42 degrees 17`S). In this paper, Stibadocerina chilensis is redescribed and illustrated in detail. A study of wing-vein homology in the subfamily Stibadocerinae is provided, to identify the components of the reduced radial sector in Stibadocerina and related taxa. The proposed hypotheses of wing-vein homology are tested, and the systematic position of Stibadocerina is assessed through a cladistic analysis of 13 characters of the male imago, scored for exemplar species of the four genera included in the Stibadocerinae. A single most parsimonious tree supports the monophyly of the Stibadocerinae and the following relationships among its included genera: Stibadocerodes [Stibadocera (Stibadocerella + Stibadocerina)]. The subfamily includes one example of a vicariant distribution with a sister-group relationship between South Central Chilean and East Asian taxa, and supports a biogeographical interpretation of an ancestral trans-Pacific biota.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We investigated the effects of dietary trans fatty acids, PUFA, and SEA on body and liver fat content, liver histology, and mRNA of enzymes involved in fatty acid metabolism. LDL receptor knockout weaning male mice were fed for 16 wk with diets containing 40% energy as either trans fatty acids (TRANS), PUFA, or SEA. Afterwards, subcutaneous and epididymal fat were weighed and histological markers of nonalcoholic fatty liver disease (NAFLD) were assessed according to the Histological Scoring System for NAFLD. PPAR alpha, PPAR gamma, microsomal triglyceride transfer protein (MTP), carnitine palmitoyl transferase 1 (CPT-1), and sterol regulatory element binding protein-1c (SREBP-1c) mRNA were measured by quantitative RT-PCR. Food intake was similar in the 3 groups, although mice fed the TRANS diet gained less weight than those receiving the PUFA diet. Compared with the PUFA- and SEA-fed mice, TRANS-fed mice had greater plasma total cholesterol (TC) and triglyceride (TG) concentrations, less epididymal and subcutaneous fat, larger livers with nonalcoholic steatohepatitis (NASH)-like lesions, and greater liver TC and TG concentrations. Macrosteatosis in TRANS-fed mice was associated with a higher homeostasis model assessment of insulin resistance (HOMA(IR)) index and upregulated mRNA related to hepatic fatty acid synthesis (SREBP-1 c and PPAR gamma) and to downregulated MTP mRNA. Diet consumption did not alter hepatic mRNA related to fatty acid oxidation (PPAR alpha and CPT-1). In conclusion, compared with PUFA- and SFA-fed mice, TRANS-fed mice had less adiposity, impaired glucose tolerance characterized by greater HOMA(IR) index, and NASH-like lesions due to greater hepatic lipogenesis. These results demonstrate the role of trans fatty acid intake on the development of key features of metabolic syndrome. J. Nutr. 140: 1127-1132, 2010.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Congenital heart disease (CHD) is the most common birth defect and the leading cause of mortality in the first year of life. In fetuses with a heart defect, chromosomal abnormalities are very frequent. Besides aneuploidy, 22q11.2 deletion is one of the most recognizable chromosomal abnormalities causing CHD. The frequency of this abnormality varies in nonselected populations. This study aimed to investigate the incidence of the 22q11.2 deletion and other chromosomal alterations in a Brazilian sample of fetuses with structural cardiac anomalies detected by fetal echocardiography. In a prospective study, 68 fetuses with a heart defect were evaluated. Prenatal detection of cardiac abnormalities led to identification of aneuploidy or structural chromosomal anomaly in 35.3% of these cases. None of the fetuses with apparently normal karyotypes had a 22q11.2 deletion. The heart defects most frequently associated with chromosomal abnormalities were atrioventricular septal defect (AVSD), ventricular septal defect (VSD), and tetralogy of Fallot. Autosomal trisomies 18 and 21 were the most common chromosomal abnormalities. The study results support the strong association of chromosome alterations and cardiac malformation, especially in AVSD and VSD, for which a chromosome investigation is indicated. In fetuses with an isolated conotruncal cardiopathy, fluorescence in situ hybridization (FISH) to investigate a 22q11.2 deletion is not indicated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Through an experimental biomechanical study on rabbits, tendon reinsertion by means of trans-osseous suture on a spongy bone bed and suture anchor were evaluated comparatively at different phases of healing. Methods: Twenty-four New Zealand White rabbits were used: 2 as pilots, 4 as the control group, and 18 as the experimental group. These 18 animals underwent sectioning and reinsertion of the Achilles tendon bilaterally, using the technique of trans-osseous suture on 1 side and suture anchor on the other. All the pelvic limbs that underwent the procedure were then immobilized for 3 weeks. The experimental group was divided into 3 groups that were sacrificed, respectively, 3, 6, and 12 weeks later. The tendon-bone complex was subjected to biomechanical tests to evaluate the parameters of maximum strength, stiffness, and yield strength. Results: There was no statistically significant difference between the suture anchor group and the trans-osseous suture group, in relation to yield strength (3 weeks, P = .222; 6 weeks, P = .465; and 12 weeks, P = .200) or maximum strength (3 weeks, P = .222; 6 weeks, P = .076; and 12 weeks, P = .078). In relation to stiffness, the suture anchor group showed a statistically significant difference only at 3 weeks of healing ( P = .032) over the trans-osseous suture group. Conclusion: The technique of suturing with an anchor was shown to be similar to the technique of trans-osseous suture for the studied parameters. Level of evidence: Basic Science Study, In-Vitro Biomechanics Study. (C) 2010 Journal of Shoulder and Elbow Surgery Board of Trustees.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conventional karyotyping detects anomalies in 3-15% of patients with multiple congenital anomalies and mental retardation (MCA/MR). Whole-genome array screening (WGAS) has been consistently suggested as the first choice diagnostic test for this group of patients, but it is very costly for large-scale use in developing countries. We evaluated the use of a combination of Multiplex Ligation-dependent Probe Amplification (MLPA) kits to increase the detection rate of chromosomal abnormalities in MCA/MR patients. We screened 261 MCA/MR patients with two subtelomeric and one microdeletion kits. This would theoretically detect up to 70% of all submicroscopic abnormalities. Additionally we scored the de Vries score for 209 patients in an effort to find a suitable cut-off for MLPA screening. Our results reveal that chromosomal abnormalities were present in 87 (33.3%) patients, but only 57 (21.8%) were considered causative. Karyotyping detected 15 abnormalities (6.9%), while MLPA identified 54 (20.7%). Our combined MLPA screening raised the total detection number of pathogenic imbalances more than three times when compared to conventional karyotyping. We also show that using the de Vries score as a cutoff for this screening would only be suitable under financial restrictions. A decision analytic model was constructed with three possible strategies: karyotype, karyotype + MLPA and karyotype + WGAS. Karyotype + MLPA strategy detected anomalies in 19.8% of cases which account for 76.45% of the expected yield for karyotype + WGAS. Incremental Cost Effectiveness Ratio (ICER) of MLPA is three times lower than that of WGAS, which means that, for the same costs, we have three additional diagnoses with MLPA but only one with WGAS. We list all causative alterations found, including rare findings, such as reciprocal duplications of regions deleted in Sotos and Williams-Beuren syndromes. We also describe imbalances that were considered polymorphisms or rare variants, such as the new SNP that confounded the analysis of the 22q13.3 deletion syndrome. (C) 2011 Elsevier Masson SAS. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim was to investigate inter-tester and intra-tester reliability and parallel reliability between a visual assessment method and a method using a pachymeter for locating the mid-point of the patella in determining the medial/lateral patella orientation. Fifteen asymptomatic subjects were assessed and the mid-point of the patella was determined by both methods on two separate occasions two weeks apart. Inter-tester reliability was obtained by ANOVA and by intraclass correlation coefficient (ICC); intra-tester reliability was obtained by a paired t-test and ICC; and parallel reliability was obtained by Pearson`s Correlation and ICC, for the measurement on the first and second evaluations. There was acceptable inter-tester agreement (p = 0.490) and reliability for the visual inspection (ICC = 0.747) and for the pachymeter (ICC = 0.716) at the second evaluation. The inter-tester reliability in the first evaluation was unacceptable (visual ICC = 0.604; pachymeter ICC = 0.612). Although there was statistical similarity between measurements for the first and second evaluations for all testers, intra-tester reliability was not acceptable for both methods: visual (examiner 1 ICC = 0.175; examiner 2 ICC = 0.189; examiner 3 ICC = 0.155) and pachymeter (examiner 1 ICC = 0.214; examiner 2 ICC = 0.246; examiner 3 ICC = 0.069). Parallel reliability gave a perfect correlation at the first evaluation (r=0.828; p<0.001) and at the second (r=0.756; p<0.001) and reliability was between acceptable and very good (ICC = [0.748-0.813]). Both visual and pachymeter methods provide reliable and similar medial/lateral patella orientation and are reliable between different examiners, but the results between the two assessments at 2 weeks` interval demonstrated an unacceptable reliability. (C) 2009 Elsevier B.V. All rights reserved.