The ENCODE (ENCyclopedia Of DNA Elements) Project.

The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

Genomic organization, fine-mapping, and expression of the human islet-brain 1 (IB1)/c-Jun-amino-terminal kinase interacting protein-1 (JIP-1) gene.

Islet-brain 1 (IB1), a regulator of the pancreatic beta-cell function in the rat, is homologous to JIP-1, a murine inhibitor of c-Jun amino-terminal kinase (JNK). Whether IB1 and JIP-1 are present in humans was not known. We report the sequence of the 2133-bp human IB1 cDNA, the expression, structure, and fine-mapping of the human IB1 gene, and the characterization of an IB1 pseudogene. Human IB1 is 94% identical to rat IB1. The tissue-specific expression of IB1 in human is similar to that observed in rodent. The IB1 gene contains 12 exons and maps to chromosome 11 (11p11.2-p12), a region that is deleted in DEFECT-11 syndrome. Apart from an IB1 pseudogene on chromosome 17 (17q21), no additional IB1-related gene was found in the human genome. Our data indicate that the sequence and expression pattern of IB1 are highly conserved between rodent and human and provide the necessary tools to investigate whether IB1 is involved in human diseases.

Human topoisomerase II-DNA interaction study by using atomic force microscopy.

Type II topoisomerases (Topo II) are unique enzymes that change the DNA topology by catalyzing the passage of two double-strands across each other by using the energy from ATP hydrolysis. In vitro, human Topo II relaxes positive supercoiled DNA around 10-fold faster than negative supercoiled DNA. By using atomic force microscopy (AFM) we found that human Topo II binds preferentially to DNA cross-overs. Around 50% of the DNA crossings, where Topo II was bound to, presented an angle in the range of 80-90°, suggesting a favored binding geometry in the chiral discrimination by Topo II. Our studies with AFM also helped us visualize the dynamics of the unknotting action of Topo II in knotted molecules.

The future is genome-wide.

A report of the annual meeting of the European Society of Human Genetics, Amsterdam, 6-9 May 2006.

Untangling the evolution of Rab G proteins: implications of a comprehensive genomic analysis.

BACKGROUND: Membrane-bound organelles are a defining feature of eukaryotic cells, and play a central role in most of their fundamental processes. The Rab G proteins are the single largest family of proteins that participate in the traffic between organelles, with 66 Rabs encoded in the human genome. Rabs direct the organelle-specific recruitment of vesicle tethering factors, motor proteins, and regulators of membrane traffic. Each organelle or vesicle class is typically associated with one or more Rab, with the Rabs present in a particular cell reflecting that cell's complement of organelles and trafficking routes. RESULTS: Through iterative use of hidden Markov models and tree building, we classified Rabs across the eukaryotic kingdom to provide the most comprehensive view of Rab evolution obtained to date. A strikingly large repertoire of at least 20 Rabs appears to have been present in the last eukaryotic common ancestor (LECA), consistent with the 'complexity early' view of eukaryotic evolution. We were able to place these Rabs into six supergroups, giving a deep view into eukaryotic prehistory. CONCLUSIONS: Tracing the fate of the LECA Rabs revealed extensive losses with many extant eukaryotes having fewer Rabs, and none having the full complement. We found that other Rabs have expanded and diversified, including a large expansion at the dawn of metazoans, which could be followed to provide an account of the evolutionary history of all human Rabs. Some Rab changes could be correlated with differences in cellular organization, and the relative lack of variation in other families of membrane-traffic proteins suggests that it is the changes in Rabs that primarily underlies the variation in organelles between species and cell types.

Genetics for clinicians: from candidate genes to whole genome scans (technological advances).

Human genetics has progressed at an unprecedented pace during the past 10 years. DNA microarrays currently allow screening of the entire human genome with high level of coverage and we are now entering the era of high-throughput sequencing. These remarkable technical advances are influencing the way medical research is conducted and have boosted our understanding of the structure of the human genome as well as of disease biology. In this context, it is crucial for clinicians to understand the main concepts and limitations of modern genetics. This review will describe key concepts in genetics, including the different types of genetic markers in the human genome, review current methods to detect DNA variation, describe major online public databases in genetics, explain key concepts in statistical genetics and finally present commonly used study designs in clinical and epidemiological research. This review will therefore concentrate on human genetic variation analysis.

Landscape of transcription in human cells.

Eukaryotic cells make many types of primary and processed RNAs that are found either in specific subcellular compartments or throughout the cells. A complete catalogue of these RNAs is not yet available and their characteristic subcellular localizations are also poorly understood. Because RNA represents the direct output of the genetic information encoded by genomes and a significant proportion of a cell's regulatory capabilities are focused on its synthesis, processing, transport, modification and translation, the generation of such a catalogue is crucial for understanding genome function. Here we report evidence that three-quarters of the human genome is capable of being transcribed, as well as observations about the range and levels of expression, localization, processing fates, regulatory regions and modifications of almost all currently annotated and thousands of previously unannotated RNAs. These observations, taken together, prompt a redefinition of the concept of a gene.

Correlation of O6-methylguanine methyltransferase (MGMT) promoter methylation with clinical outcomes in glioblastoma and clinical strategies to modulate MGMT activity.

Resistance to alkylating agents via direct DNA repair by O(6)-methylguanine methyltransferase (MGMT) remains a significant barrier to the successful treatment of patients with malignant glioma. The relative expression of MGMT in the tumor may determine response to alkylating agents, and epigenetic silencing of the MGMT gene by promoter methylation plays an important role in regulating MGMT expression in gliomas. MGMT promoter methylation is correlated with improved progression-free and overall survival in patients treated with alkylating agents. Strategies to overcome MGMT-mediated chemoresistance are being actively investigated. These include treatment with nontoxic pseudosubstrate inhibitors of MGMT, such as O(6)-benzylguanine, or RNA interference-mediated gene silencing of MGMT. However, systemic application of MGMT inhibitors is limited by an increase in hematologic toxicity. Another strategy is to deplete MGMT activity in tumor tissue using a dose-dense temozolomide schedule. These alternative schedules are well tolerated; however, it remains unclear whether they are more effective than the standard dosing regimen or whether they effectively deplete MGMT activity in tumor tissue. Of note, not all patients with glioblastoma having MGMT promoter methylation respond to alkylating agents, and even those who respond will inevitably experience relapse. Herein we review the data supporting MGMT as a major mechanism of chemotherapy resistance in malignant gliomas and describe ongoing studies that are testing resistance-modulating strategies.

Identification of novel functional TBP-binding sites and general factor repertoires.

Our current knowledge of the general factor requirement in transcription by the three mammalian RNA polymerases is based on a small number of model promoters. Here, we present a comprehensive chromatin immunoprecipitation (ChIP)-on-chip analysis for 28 transcription factors on a large set of known and novel TATA-binding protein (TBP)-binding sites experimentally identified via ChIP cloning. A large fraction of identified TBP-binding sites is located in introns or lacks a gene/mRNA annotation and is found to direct transcription. Integrated analysis of the ChIP-on-chip data and functional studies revealed that TAF12 hitherto regarded as RNA polymerase II (RNAP II)-specific was found to be also involved in RNAP I transcription. Distinct profiles for general transcription factors and TAF-containing complexes were uncovered for RNAP II promoters located in CpG and non-CpG islands suggesting distinct transcription initiation pathways. Our study broadens the spectrum of general transcription factor function and uncovers a plethora of novel, functional TBP-binding sites in the human genome.

High-throughput SELEX SAGE method for quantitative modeling of transcription-factor binding sites.

The ability to determine the location and relative strength of all transcription-factor binding sites in a genome is important both for a comprehensive understanding of gene regulation and for effective promoter engineering in biotechnological applications. Here we present a bioinformatically driven experimental method to accurately define the DNA-binding sequence specificity of transcription factors. A generalized profile was used as a predictive quantitative model for binding sites, and its parameters were estimated from in vitro-selected ligands using standard hidden Markov model training algorithms. Computer simulations showed that several thousand low- to medium-affinity sequences are required to generate a profile of desired accuracy. To produce data on this scale, we applied high-throughput genomics methods to the biochemical problem addressed here. A method combining systematic evolution of ligands by exponential enrichment (SELEX) and serial analysis of gene expression (SAGE) protocols was coupled to an automated quality-controlled sequence extraction procedure based on Phred quality scores. This allowed the sequencing of a database of more than 10,000 potential DNA ligands for the CTF/NFI transcription factor. The resulting binding-site model defines the sequence specificity of this protein with a high degree of accuracy not achieved earlier and thereby makes it possible to identify previously unknown regulatory sequences in genomic DNA. A covariance analysis of the selected sites revealed non-independent base preferences at different nucleotide positions, providing insight into the binding mechanism.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

A genomewide scan for early-onset coronary artery disease in 438 families: the GENECARD Study.

A family history of coronary artery disease (CAD), especially when the disease occurs at a young age, is a potent risk factor for CAD. DNA collection in families in which two or more siblings are affected at an early age allows identification of genetic factors for CAD by linkage analysis. We performed a genomewide scan in 1,168 individuals from 438 families, including 493 affected sibling pairs with documented onset of CAD before 51 years of age in men and before 56 years of age in women. We prospectively defined three phenotypic subsets of families: (1) acute coronary syndrome in two or more siblings; (2) absence of type 2 diabetes in all affected siblings; and (3) atherogenic dyslipidemia in any one sibling. Genotypes were analyzed for 395 microsatellite markers. Regions were defined as providing evidence for linkage if they provided parametric two-point LOD scores >1.5, together with nonparametric multipoint LOD scores >1.0. Regions on chromosomes 3q13 (multipoint LOD = 3.3; empirical P value <.001) and 5q31 (multipoint LOD = 1.4; empirical P value <.081) met these criteria in the entire data set, and regions on chromosomes 1q25, 3q13, 7p14, and 19p13 met these criteria in one or more of the subsets. Two regions, 3q13 and 1q25, met the criteria for genomewide significance. We have identified a region on chromosome 3q13 that is linked to early-onset CAD, as well as additional regions of interest that will require further analysis. These data provide initial areas of the human genome where further investigation may reveal susceptibility genes for early-onset CAD.

The clc element and related genomic islands in Proteobacteria

Genomic islands are large DNA segments, present in most bacterial genome, that are acquired via horizontal gene transfer and contribute to the rapid bacterial evolution and adaptation of the host cell. Here we focus on the clc element (or ICEclc), a 103‑kb genomic island first discovered in Pseudomonas knackmussii B13, as a model of this diverse group of mobile genetic elements. ICEclc is normally integrated in the host bacterial chromosome but can excise and transfer to a new host by conjugation. In this chapter we review the basic features of ICEclc, the mechanisms of its life‑style as well as evolutionary relationships with other known and unknown elements in a variety of Proteobacteria.

Genome-wide RNA polymerase II profiles and RNA accumulation reveal kinetics of transcription and associated epigenetic changes during diurnal cycles.

Interactions of cell-autonomous circadian oscillators with diurnal cycles govern the temporal compartmentalization of cell physiology in mammals. To understand the transcriptional and epigenetic basis of diurnal rhythms in mouse liver genome-wide, we generated temporal DNA occupancy profiles by RNA polymerase II (Pol II) as well as profiles of the histone modifications H3K4me3 and H3K36me3. We used these data to quantify the relationships of phases and amplitudes between different marks. We found that rhythmic Pol II recruitment at promoters rather than rhythmic transition from paused to productive elongation underlies diurnal gene transcription, a conclusion further supported by modeling. Moreover, Pol II occupancy preceded mRNA accumulation by 3 hours, consistent with mRNA half-lives. Both methylation marks showed that the epigenetic landscape is highly dynamic and globally remodeled during the 24-hour cycle. While promoters of transcribed genes had tri-methylated H3K4 even at their trough activity times, tri-methylation levels reached their peak, on average, 1 hour after Pol II. Meanwhile, rhythms in tri-methylation of H3K36 lagged transcription by 3 hours. Finally, modeling profiles of Pol II occupancy and mRNA accumulation identified three classes of genes: one showing rhythmicity both in transcriptional and mRNA accumulation, a second class with rhythmic transcription but flat mRNA levels, and a third with constant transcription but rhythmic mRNAs. The latter class emphasizes widespread temporally gated posttranscriptional regulation in the mouse liver.

Methylation of CpG island promoters in uveal melanoma.

BACKGROUND: Inactivation of tumour-related genes by promoter hypermethylation is a common epigenetic event in the development of a variety of tumours. AIM: To investigate in primary uveal melanoma the status of promoter methylation of genes thought to be involved in tumour development: p16, TIMP3, RASSF1, RARB, FHIT, hTERT and APC. METHODS: Gene promoter methylation was studied by methylation-sensitive single-strand conformation analysis and dot-blot assay in a series of 23 primary uveal melanomas. All DNA samples were obtained from paraffin-embedded formalin-fixed tissue blocks. RESULTS: hTERT promoter methylation was found with a relatively high frequency (52%). Promoter methylation of p16, TIMP3, RASSF1, RARB, FHIT and APC was a rare event. For none of these genes did promoter methylation exceed 15% of tumour samples, and, for some genes (FHIT and APC), no methylation was found at all. Furthermore, promoter methylation was absent in 39% (9/23) of cases. In only 22% (5/23) of cases was hypermethylation of at least two promoters observed. CONCLUSIONS: Promoter methylation of hTERT is a regular event in uveal melanoma. Hypermethylation of the other genes studied does not seem to be an essential element in the development of this tumour. As promoter methylation of APC, RASSF1 and RARB is often observed in cutaneous melanoma, these results suggest that different epigenetic events occur in the development of cutaneous and uveal melanoma.