Analysis of bulk and surface contributions in the neutron skin of nuclei

The neutron skin thickness of nuclei is a sensitive probe of the nuclear symmetry energy and has multiple implications for nuclear and astrophysical studies. However, precision measurements of this observable are difficult to obtain. The analysis of the experimental data may imply some assumptions about the bulk or surface nature of the formation of the neutron skin. Here we study the bulk or surface character of neutron skins of nuclei following from calculations with Gogny, Skyrme, and covariant nuclear mean-field interactions. These interactions are successful in describing nuclear charge radii and binding energies but predict different values for neutron skins. We perform the study by fitting two-parameter Fermi distributions to the calculated self-consistent neutron and proton densities. We note that the equivalent sharp radius is a more suitable reference quantity than the half-density radius parameter of the Fermi distributions to discern between the bulk and surface contributions in neutron skins. We present calculations for nuclei in the stability valley and for the isotopic chains of Sn and Pb.

Numerical Studies of Dark Energy Models and Observations

The cosmological standard view is based on the assumptions of homogeneity, isotropy and general relativistic gravitational interaction. These alone are not sufficient for describing the current cosmological observations of accelerated expansion of space. Although general relativity is extremely accurately tested to describe the local gravitational phenomena, there is a strong demand for modifying either the energy content of the universe or the gravitational interaction itself to account for the accelerated expansion. By adding a non-luminous matter component and a constant energy component with negative pressure, the observations can be explained with general relativity. Gravitation, cosmological models and their observational phenomenology are discussed in this thesis. Several classes of dark energy models that are motivated by theories outside the standard formulation of physics were studied with emphasis on the observational interpretation. All the cosmological models that seek to explain the cosmological observations, must also conform to the local phenomena. This poses stringent conditions for the physically viable cosmological models. Predictions from a supergravity quintessence model was compared to Supernova 1a data and several metric gravity models were studied with local experimental results. Polytropic stellar configurations of solar, white dwarf and neutron stars were numerically studied with modified gravity models. The main interest was to study the spacetime around the stars. The results shed light on the viability of the studied cosmological models.

Isospin-rich nuclei in neutron star matter

Stability of nuclei beyond the drip lines in the presence of an enveloping gas of nucleons and electrons, as prevailing in the inner crust of a neutron star, is studied in the temperature-dependent Thomas-Fermi framework. A limiting asymmetry in the isospin space beyond which nuclei cannot exist emerges from the calculations. The ambient conditions such as temperature, baryon density, and neutrino concentration under which these exotic nuclear systems can be formed are studied in some detail.

Structure of AuCN determined from total neutron diffraction

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Three dimensional picture of the local structure of 1,4-Polybutadiene from a complete atomistic model and neutron scattering data

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.

Towards the main sequence: detailed analysis of weak line and post-T Tauri stars

A detailed study was performed for a sample of low-mass pre-main-sequence (PMS) stars, previously identified as weak-line T Tauri stars, which are compared to members of the Tucanae and Horologium Associations. Aiming to verify if there is any pattern of abundances when comparing the young stars at different phases, we selected objects in the range from 1 to 100 Myr, which covers most of PMS evolution. High-resolution optical spectra were acquired at European Southern Observatory and Observatorio do Pico dos Dias. The stellar fundamental parameters effective temperature and gravity were calculated by excitation and ionization equilibria of iron absorption lines. Chemical abundances were obtained via equivalent width calculations and spectral synthesis for 44 per cent of the sample, which shows metallicities within 0.5 dex solar. A classification was developed based on equivalent width of Li I 6708 angstrom and Ha lines and spectral types of the studied stars. This classification allowed a separation of the sample into categories that correspond to different evolutive stages in the PMS. The position of these stars in the Hertzsprung-Russell diagram was also inspected in order to estimate their ages and masses. Among the studied objects, it was verified that our sample actually contains seven weak-line T Tauri stars, three are Classical T Tauri, 12 are Fe/Ge PMS stars and 21 are post-T Tauri or young main-sequence stars. An estimation of circumstellar luminosity was obtained using a disc model to reproduce the observed spectral energy distribution. Most of the stars show low levels of circumstellar emission, corresponding to less than 30 per cent of the total emission.

On the use of rotational splitting asymmetries to probe the internal rotation profile of stars: Application to beta Cephei stars

Rotationally-split modes can provide valuable information about the internal rotation profile of stars. This has been used for years to infer the internal rotation behavior of the Sun. The present work discusses the potential additional information that rotationally splitting asymmetries may provide when studying the internal rotation profile of stars. We present here some preliminary results of a method, currently under development, which intends: 1) to understand the variation of the rotational splitting asymmetries in terms of physical processes acting on the angular momentum distribution in the stellar interior, and 2) how this information can be used to better constrain the internal rotation profile of the stars. The accomplishment of these two objectives should allow us to better use asteroseismology as a test-bench of the different theories describing the angular momentum distribution and evolution in the stellar interiors. (C) 2010 WILEY-VCH Verlag GmbH&Co. KGaA, Weinheim

Are the magnetic fields of millisecond pulsars similar to 10(8) G?

It is generally assumed that the magnetic fields of millisecond pulsars (MSPs) are similar to 10(8) G. We argue that this may not be true and the fields may be appreciably greater. We present six evidences for this: (1) The similar to 10(8)G field estimate is based on magnetic dipole emission losses which is shown to be questionable; (2) The MSPs in low mass X-ray binaries (LMXBs) are claimed to have < 10(11) G on the basis of a Rayleygh-Taylor instability accretion argument. We show that the accretion argument is questionable and the upper limit 10(11) G may be much higher; (3) Low magnetic field neutron stars have difficulty being produced in LMXBs; (4) MSPs may still be accreting indicating a much higher magnetic field; (5) The data that predict similar to 10(8) G for MSPs also predict ages on the order of, and greater than, ten billion years, which is much greater than normal pulsars. If the predicted ages are wrong, most likely the predicted similar to 10(8) G fields of MSPs are wrong; (6) When magnetic fields are measured directly with cyclotron lines in X-ray binaries, fields a parts per thousand << 10(8) G are indicated. Other scenarios should be investigated. One such scenario is the following. Over 85% of MSPs are confirmed members of a binary. It is possible that all MSPs are in large separation binaries having magnetic fields > 10(8) G with their magnetic dipole emission being balanced by low level accretion from their companions.

Nonmesonic weak decay spectra of (4)(Lambda)He

To comprehend the recent Brookhaven National Laboratory experiment E788 on (4)(Lambda)He, we have outlined a simple theoretical framework. based on the independent-particle shell model, for the one-nucleon-induced nonmesonic weak decay spectra. Basically, the shapes of all the spectra are tailored by the kinematics of the corresponding phase space, depending very weakly on the dynamics, which is gauged here by the one-meson-exchange potential. In spite of the straightforwardness of the approach a good agreement with data is achieved. This might be an indication that the final-state-interactions and the two-nucleon induced processes are not very important in the decay of this hypernucleus. We have also found that the pi + K exchange potential with soft vertex-form-factor cutoffs (Lambda(pi) approximate to 0.7 GeV, Lambda(K) approximate to 0.9 GeV), is able to account simultaneously for the available experimental data related to Gamma(p) and Gamma(n) for (4)(Lambda)H, (4)(Lambda)H, and (5)(Lambda)H. (C) 2009 Elsevier B.V. All rights reserved.

Tectonothermal evolution and exhumation history of the Paleozoic Proto-Andean Gondwana margin crust: The Famatinian Belt in NW Argentina

We studied the P-T-t evolution of a mid-crustal igneous-metamorphic segment of the Famatinian Belt in the eastern sector of the Sierra de Velasco during its exhumation to the upper crust. Thermobarometric and geochronological methods combined with field observations permit us to distinguish three tectonic levels. The deepest Level I is represented by metasedimentary xenoliths and characterized by prograde isobaric heating at 20-25 km depth. Early/Middle Ordovician granites that contain xenoliths of Level I intruded in the shallower Level II. The latter is characterized by migmatization coeval with granitic intrusions and a retrograde isobaric cooling P-T path at 14-18 km depth. Level II was exhumed to the shallowest supracrustal Level III, where it was intruded by cordierite-bearing granites during the Middle/Late Ordovician and its host-rock was locally affected by high temperature-low pressure HT/LP metamorphism at 8-10 km depth. Level III was eventually intruded by Early Carboniferous granites after long-term slow exhumation to 6-7 km depth. Early/Middle Ordovician exhumation of Level II to Level III (Exhumation Period I,0.25-0.78 mm/yr) was faster than exhumation of Level III from the Middle/Late Ordovician to the Lower Carboniferous (Exhumation Period II, 0.01-0.09 mm/yr). Slow exhumation rates and the lack of regional evidence of tectonic exhumation suggest that erosion was the main exhumation mechanism of the Famatinian Belt. Widespread slow exhumation associated with crustal thickening under a HT regime suggests that the Famatinian Belt represents the middle crust of an ancient Altiplano-Puna-like orogen. This thermally weakened over-thickened Famatinian crust was slowly exhumed mainly by erosion during similar to 180 Myr. (C) 2010 International Association for Gondwana Research. Published by Elsevier B.V. All rights reserved.

Awaking the Vacuum in Relativistic Stars

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Perturbative breaking of the pseudospin symmetry in the relativistic harmonic oscillator

We show that relativistic mean fields theories with scalar S, and vector V, quadratic radial potentials can generate a harmonic oscillator with exact pseudospin symmetry and positive energy bound states when S = -V. The eigenenergies are quite different from those of the non-relativistic harmonic oscillator. We also discuss a mechanism for perturbatively breaking this, symmetry by introducing a tensor potential. Our results shed light into the intrinsic relativistic nature of the pseudospin symmetry, which might be important in high density systems such as neutron stars.

Neutron Diffraction Study of Liquid N-Methylformamide Using EPSR Simulation

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Distribution of refractory and volatile elements in CoRoT exoplanet host stars

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)