989 resultados para Chromosomal aberrations


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Numerous potentially mutagenic chemicals have been studied mainly because they can cause damaging and inheritable changes in the genetic material. Several tests are commonly used for biomonitoring pollution levels and to evaluate the effects of toxic and mutagenic agents present in the natural environment. This study aimed at assessing the potential of a textile effluent contaminated with azo dyes to induce chromosomal and nuclear aberrations in Allium cepa test systems. A continuous exposure of seeds in samples of the textile effluent in different concentrations was carried out (0.3%, 3%, 10%, and 100%). Cells in interphase and undergoing division were examined to assess the presence of chromosome aberrations, nuclear changes, and micronuclei. Our results revealed a mutagenic effect of the effluent at concentrations of 10% and 100%. At lower concentrations, the effluent (3% and 0.3%) did not induce mutagenic alterations in the test organism A. cepa. These findings are of concern, since cell damage may be transmitted to subsequent generations, possibly affecting the organism as a whole, as well as the local biota exposed to the effluent discharge. If the damage results in cell death, the development of the organism may be affected, which could also lead to its death. © 2008 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVE: Chromosomal instability is a key feature in hepatocellular carcinoma (HCC). Array comparative genomic hybridization (aCGH) revealed recurring structural aberrations, whereas fluorescence in situ hybridization (FISH) indicated an increasing number of numerical aberrations in dedifferentiating HCC. Therefore, we examined whether there was a correlation between structural and numerical aberrations of chromosomal instability in HCC. METHODS AND RESULTS: 27 HCC (5 well, 10 moderately, 12 lower differentiated) already cytogenetically characterized by aCGH were analyzed. FISH analysis using probes for chromosomes 1, 3, 7, 8 and 17 revealed 1.46-4.24 signals/nucleus, which correlated with the histological grade (well vs. moderately,p < 0.0003; moderately vs. lower, p < 0.004). The number of chromosomes to each other was stable with exceptions only seen for chromosome 8. Loss of 4q and 13q, respectively, were correlated with the number of aberrations detected by aCGH (p < 0.001, p < 0.005; Mann-Whitney test). Loss of 4q and gain of 8q were correlated with an increasing number of numerical aberrations detected by FISH (p < 0.020, p < 0.031). Loss of 8p was correlated with the number of structural imbalances seen in aCGH (p < 0.048), but not with the number of numerical changes seen in FISH. CONCLUSION: We found that losses of 4q, 8p and 13q were closely correlated with an increasing number of aberrations detected by aCGH, whereas a loss of 4q and a gain of 8q were also observed in the context of polyploidization, the cytogenetic correlate of morphological dedifferentiation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

It has long been known that rearrangements of chromosomes through breakage-fusion-bridge (BFB) cycles may cause variability of phenotypic and genetic traits within a cell population. Because intercellular heterogeneity is often found in neoplastic tissues, we investigated the occurrence of BFB events in human solid tumors. Evidence of frequent BFB events was found in malignancies that showed unspecific chromosome aberrations, including ring chromosomes, dicentric chromosomes, and telomeric associations, as well as extensive intratumor heterogeneity in the pattern of structural changes but not in tumors with tumor-specific aberrations and low variability. Fluorescence in situ hybridization analysis demonstrated that chromosomes participating in anaphase bridge formation were involved in a significantly higher number of structural aberrations than other chromosomes. Tumors with BFB events showed a decreased elimination rate of unstable chromosome aberrations after irradiation compared with normal cells and other tumor cells. This result suggests that a combination of mitotically unstable chromosomes and an elevated tolerance to chromosomal damage leads to constant genomic reorganization in many malignancies, thereby providing a flexible genetic system for clonal evolution and progression.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To obtain a comprehensive genomic profile of presenting multiple myeloma cases we performed high-resolution single nucleotide polymorphism mapping array analysis in 114 samples alongside 258 samples analyzed by U133 Plus 2.0 expression array (Affymetrix). We examined DNA copy number alterations and loss of heterozygosity (LOH) to define the spectrum of minimally deleted regions in which relevant genes of interest can be found. The most frequent deletions are located at 1p (30%), 6q (33%), 8p (25%), 12p (15%), 13q (59%), 14q (39%), 16q (35%), 17p (7%), 20 (12%), and 22 (18%). In addition, copy number-neutral LOH, or uniparental disomy, was also prevalent on 1q (8%), 16q (9%), and X (20%), and was associated with regions of gain and loss. Based on fluorescence in situ hybridization and expression quartile analysis, genes of prognostic importance were found to be located at 1p (FAF1, CDKN2C), 1q (ANP32E), and 17p (TP53). In addition, we identified common homozygously deleted genes that have functions relevant to myeloma biology. Taken together, these analyses indicate that the crucial pathways in myeloma pathogenesis include the nuclear factor-κB pathway, apoptosis, cell-cycle regulation, Wnt signaling, and histone modifications. This study was registered at http://isrctn.org as ISRCTN68454111.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Contemporary anticancer therapies have largely improved the outcome for children with cancer, especially for Acute Lymphoblastic Leukemia (ALL). Actually, between 78% and 85% of patients achieve complete remission and are alive after 5 years of therapy completion. However, as cure rates increase, new concerns about the late effects of genotoxic treatment emerge, being the risk of developing secondary neoplasias, the most serious life-threatening rising problem. In the present paper, we describe and review the cytogenetic findings in peripheral lymphocytes from ALL survivors, and discuss aspects associated to the occurrence of increased chromosome rearrangements in this growing cohort.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: The Trypanosoma cruzi genome was sequenced from a hybrid strain (CL Brener). However, high allelic variation and the repetitive nature of the genome have prevented the complete linear sequence of chromosomes being determined. Determining the full complement of chromosomes and establishing syntenic groups will be important in defining the structure of T. cruzi chromosomes. A large amount of information is now available for T. cruzi and Trypanosoma brucei, providing the opportunity to compare and describe the overall patterns of chromosomal evolution in these parasites. Methodology/Principal Findings: The genome sizes, repetitive DNA contents, and the numbers and sizes of chromosomes of nine strains of T. cruzi from four lineages (TcI, TcII, TcV and TcVI) were determined. The genome of the TcI group was statistically smaller than other lineages, with the exception of the TcI isolate Tc1161 (Jose-IMT). Satellite DNA content was correlated with genome size for all isolates, but this was not accompanied by simultaneous amplification of retrotransposons. Regardless of chromosomal polymorphism, large syntenic groups are conserved among T. cruzi lineages. Duplicated chromosome-sized regions were identified and could be retained as paralogous loci, increasing the dosage of several genes. By comparing T. cruzi and T. brucei chromosomes, homologous chromosomal regions in T. brucei were identified. Chromosomes Tb9 and Tb11 of T. brucei share regions of syntenic homology with three and six T. cruzi chromosomal bands, respectively. Conclusions: Despite genome size variation and karyotype polymorphism, T. cruzi lineages exhibit conservation of chromosome structure. Several syntenic groups are conserved among all isolates analyzed in this study. The syntenic regions are larger than expected if rearrangements occur randomly, suggesting that they are conserved owing to positive selection. Mapping of the syntenic regions on T. cruzi chromosomal bands provides evidence for the occurrence of fusion and split events involving T. brucei and T. cruzi chromosomes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Western European house mouse, Mus domesticus, includes many distinct Robertsonian (Rb) chromosomal races. Two competing hypotheses may explain the distribution of Rb translocations found in different populations: they may have arisen independently multiple times or they may have arisen once and been spread through long distance dispersal. We investigated the origin of the Rb 5.15 translocation using 6 microsatellite loci linked to the centromeres of chromosomes 5 and 15 in 84 individuals from 3 Rb populations and 4 neighboring standard-karyotype populations. Microsatellite variation on the 5.15 metacentric chromosomes was significantly reduced relative to the amount of variation found on acrocentric chromosomes 5 and 15, suggesting that linked microsatellite loci can track specific mutational events. Phylogenetic analyses resulted in trees which are consistent with multiple origins of the 5.15 metacentric found in the three Rb populations. These results suggest that cytologically indistinguishable mutations have arisen independently in natural populations of house mice.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).