46,XY disorders of sex development (DSD)

The term disorders of sex development (DSD) includes congenital conditions in which development of chromosomal, gonadal or anatomical sex is atypical. Mutations in genes present in X, Y or autosomal chromosomes can cause abnormalities of testis determination or disorders of sex differentiation leading to 46,XY DSD. Detailed clinical phenotypes allow the identification of new factors that can alter the expression or function of mutated proteins helping to understand new undisclosed biochemical pathways. In this review we present an update on 46,XY DSD aetiology, diagnosis and treatment based on extensive review of the literature and our three decades of experience with these patients.

Mucosal Leishmaniasis and Abnormalities on Computed Tomographic Scans of Paranasal Sinuses

Studies evaluating radiologic aspects, local complications, and structural alterations of the paranasal sinus in patients with mucosal leishmaniasis (ML) are lacking The aim of this study was to analyze alterations of the paranasal sinuses in patients with ML by using computed tomography (CT) scans This prospective study evaluated 26 patients in Brazil with ML Nom December 2008 through June 2009 All patients underwent CT scans of the paranasal sinuses Paranasal thickening was observed in 25 patients (96%) Nasal perforation was observed in 17 patients (65%) Those patients who received re-treatment showed more abnormalities on CT scan than cured patients (P < 0 05) Complications of ML are not limited to the nasal mucosa but extend to the paranasal sinuses. Mucosa! thickening. pacified air cells. bony remodeling, and bony thickening caused by inflammatory steals of the sinus cavity walls are CT findings suggestive of chronic sinusitis

Skeletal Microstructural Abnormalities in Postmenopausal Women With Chronic Obstructive Pulmonary Disease

Chronic obstructive pulmonary disease (COPD) is associated with osteoporosis and fragility fractures. The objectives of this study were to assess static and dynamic indices of cancellous and cortical bone structure in postmenopausal women with COPD. Twenty women with COPD who had not received chronic oral glucocorticoids underwent bone biopsies after double tetracycline labeling. Biopsies were analyzed by histomorphometry and mu CT and compared with age-matched controls. Distribution of the patients according to the Global Initiative for Chronic Obstructive Lung Disease (GOLD) was: Type I (15%), Type II (40%), Type III (30%), and Type IV (15%). Mean (+/-SD) cancellous bone volume (15.20 +/- 5.91 versus 21.34 +/- 5.53%, p = .01), trabecular number (1.31 +/- 0.26 versus 1.77 +/- 0.51/mm, p = .003), and trabecular thickness (141 +/- 23 versus 174 +/- 36 mu m, p = .006) were lower in patients than in controls. Connectivity density was lower in COPD (5.56 +/- 2.78 versus 7.94 +/- 3.08 mu m, p = .04), and correlated negatively with smoking (r = -0.67; p = .0005). Trabecular separation (785 +/- 183 versus 614 +/- 136 mu m, p = .01) and cortical porosity (4.11 +/- 1.02 versus 2.32 +/- 0.94 voids/mm(2); p < .0001) were higher in COPD while cortical width (458 +/- 214 versus 762 +/- 240 mu m; p < .0001) was lower. Dynamic parameters showed significantly lower mineral apposition rate in COPD (0.56 +/- 0.16 versus 0.66 +/- 0.12 mu m/day; p = .01). Patients with more severe disease, GOLD III and IV, presented lower bone formation rate than GOLDI and II (0.028 +/- 0.009 versus 0.016 +/- 0.011 mu m(3)/mu m(2)/day;p = 04). This is the first evaluation of bone microstructure and remodeling in COPD. The skeletal abnormalities seen in cancellous and cortical bone provide an explanation for the high prevalence of vertebral fractures in this disease. (C) 2010 American Society for Bone and Mineral Research.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relationship between induced sputum cytology and inflammatory status with lung structural and functional abnormalities in asbestosis

Background Asbestosis is associated with lung cellular and immunological abnormalities. Induced sputum cytology and local and systemic markers of inflammation may be helpful to characterize disease status and progression in these patients. Methods Thirty-nine ex-workers with asbestosis on high-resolution CT (HRCT) and 21 non-exposed controls were evaluated. Sputum cytology and IL-8 in serum and sputum were related to lung function impairment. Results Subjects with asbestosis had reduced sputum cellularity but higher macrophagel neutrophil ratio and % macrophage as compared with controls. Sputum and serum IL-8 were also higher in patients with asbestosis (P < 0.05). In addition, evidence of lung architectural distorption on HRCT was associated with increased levels of serum IL-8. Interestingly, absolute macrophage number was negatively correlated with total lung capacity (r = -0.40; P = 0.04) and serum IL-8 to lung diffiusing capacity (r = -0.45; P = 0.01). Conclusions Occupationally exposed subjects with asbestosis on HRCT have cytologic abnormalities in induced sputum and increased local and systemic pro-inflammatory status which are correlated to functional impairment.

Lung Diffusing Capacity Relates Better to Short-Term Progression on HRCT Abnormalities Than Spirometry in Mild Asbestosis

Background Pulmonary function tests (PFT), particularly spirometry and lung diffusing capacity for carbon monoxide (DL(CO)), have been considered useful methods for the detection of the progression of interstitial asbestos abnormalities as indicated by high-resolution computed tomography (HRCT). However, it is currently unknown which of these two tests correlates best with anatomical changes over time. Methods In this study, we contrasted longitudinal changes (3-9 years follow-up) in PFTs at rest and during exercise with interstitial abnormalities evaluated by HRCT in 63 ex-workers with mild-to-moderate asbestosis. Results At baseline, patients presented with low-grade asbestosis (Huuskonen classes I-II), and most PFT results were within the limits of normality. In the follow-up, most subjects had normal spirometry, static lung volumes and arterial blood gases. In contrast, frequency of DL(CO) abnormalities almost doubled (P < 0.05). Twenty-three (36.5%) subjects increased the interstitial marks on HRCT. These had significantly larger declines in DL(CO) compared to patients who remained stable (0.88 vs. 0.31 ml/min/mm Hg/year and 3.5 vs. 1.2%/year, respectively; P < 0.05). In contrast, no between-group differences were found for the other functional tests, including spirometry (P > 0.05). Conclusions These data demonstrate that the functional consequences of progression of HRCT abnormalities in mild-to-moderate asbestosis are better reflected by decrements in DL(CO) than by spirometric changes. These results might have important practical implications for medico-legal evaluation of this patient population. Am. J. Ind. Med. 54:185-193, 2011. (c) 2010 Wiley-Liss, Inc.

Effects of high-intensity aerobic interval training vs. moderate exercise on hemodynamic, metabolic and neuro-humoral abnormalities of young normotensive women at high familial risk for hypertension

Exercise training has an important role in the prevention and treatment of hypertension, but its effects on the early metabolic and hemodynamic abnormalities observed in normotensive offspring of hypertensive parents (FH+) have not been studied. We compared high-intensity interval (aerobic interval training, AIT) and moderate-intensity continuous exercise training (CMT) with regard to hemodynamic, metabolic and hormonal variables in FH+ subjects. Forty-four healthy FH+ women (25.0+/-4.4 years) randomized to control (ConFH+) or to a three times per week equal-volume AIT (80-90% of VO(2MAX)) or CMT (50-60% of VO(2MAX)) regimen, and 15 healthy women with normotensive parents (ConFH-; 25.3+/-3.1 years) had their hemodynamic, metabolic and hormonal variables analyzed at baseline and after 16 weeks of follow-up. Ambulatorial blood pressure (ABP), glucose and cholesterol levels were similar among all groups, but the FH+ groups showed higher insulin, insulin sensitivity, carotid-femoral pulse wave velocity (PWV), norepinephrine and endothelin-1 (ET-1) levels and lower nitrite/ nitrate (NOx) levels than ConFH- subjects. AIT and CMT were equally effective in improving ABP (P<0.05), insulin and insulin sensitivity (P<0.001); however, AIT was superior in improving cardiorespiratory fitness (15 vs. 8%; P<0.05), PWV (P<0.01), and BP, norepinephrine, ET-1 and NOx response to exercise (P<0.05). Exercise intensity was an important factor in improving cardiorespiratory fitness and reversing hemodynamic, metabolic and hormonal alterations involved in the pathophysiology of hypertension. These findings may have important implications for the exercise training programs used for the prevention of inherited hypertensive disorder. Hypertension Research (2010) 33, 836-843; doi:10.1038/hr.2010.72; published online 7 May 2010

Asbestos-related Disease Progression of Parenchymal Abnormalities on High-resolution CT

Purpose: To evaluate the changes over time in the pattern and extent of parenchymal abnormalities in asbestos-exposed workers after cessation of exposure and to compare 3 proposed semiquantitative methods with a careful side-by-side comparison of the initial and the follow-Lip computed tomography (CT) images. Materials and Methods: The study included 52 male asbestos workers (mean age SD, 62.2y +/- 8.2) who had baseline high-resolution CT after cessation of exposure and follow-up CT 3 to 5 years later. Two independent thoracic radiologists quantified the findings according to the scoring systems proposed by Huuskonen, Gamsu, and Sette and then did a side-by-side comparison of the 2 sets of scans without awareness of the dates of the CT scans. Results: There was no difference in the prevalence of the 2 most common parenchymal abnormalities (centrilobular small dotlike or branching opacities and interstitial lines) between the initial and follow-up CT scans. Honeycombing (20%) and traction bronchiectasis and bronchiolectasis (50%) were seen more commonly on the follow-up CT than on the initial examination (10% and 33%, respectively) (P = 0.01). Increased extent of parenchymal abnormalities was evident on side-by-side comparison in 42 (81%) patients but resulted in an increase in score in at least 1 semiquantitative system in only 16 (31%) patients (all P > 0.01, signed test). Conclusions: The majority of patients with previous asbestos exposure show evidence of progression of disease on CT at 3 to 5 years follow-up but this progression is usually not detected by the 3 proposed semiquantitative scoring schemes.

Ocular abnormalities in chronic schizophrenia: clinical implications

Objective: As part of a randomised double-blind study of a new atypical antipsychotic we sought to determine both the levels of visual acuity and the occurrence of toxic side-effects in a group of patients treated for many years on a variety of antipsychotics. Method: Twenty-three inpatients with a DSM-III-R diagnosis of chronic schizophrenia from two separate hospital locations who met the criteria for the double-blind trial were examined for ocular abnormalities at both baseline and at trial completion. Results: At baseline a high prevalence of abnormalities was identified: 19 patients (82.6%) were found to have one or more ocular abnormalities, including lens opacities/cataracts and corneal pigmentation; three patients, with delusions related to the sun, were noted to have solar burns; a high proportion (almost 70%) of patients had untreated visual acuity problems. No further changes were observed at the follow-up examinations. Conclusions: The possible causes of ocular disturbance in schizophrenia and the reasons for the relatively high ocular morbidity in this group are thought to result from both illness-related factors and the effects of antipsychotic medication. Causality is confounded by a number of issues such as the high prevalence of smoking, poor general health and the variety of antipsychotic medications used in the treatment of psychosis as well as substance abuse. The clinical implications are considered in this paper in relation to the move towards community-based psychiatric services.

Identification and chromosomal localization of one locus of Leishmania (L.) major related with resistance to itraconazole

Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.

Lack of progression of brain abnormalities in first-episode psychosis: a longitudinal magnetic resonance imaging study

Background. Some neuroimaging studies have supported the hypothesis of progressive brain changes after a first episode of psychosis. We aimed to determine whether (i) first-episode psychosis patients would exhibit more pronounced brain volumetric changes than controls over time and (ii) illness course/treatment would relate to those changes. Method. Longitudinal regional grey matter volume and ventricle : brain ratio differences between 39 patients with first-episode psychosis (including schizophrenia and schizophreniform disorder) and 52 non-psychotic controls enrolled in a population-based case-control study. Results. While there was no longitudinal difference in ventricle : brain ratios between first-episode psychosis subjects and controls, patients exhibited grey matter volume changes, indicating a reversible course in the superior temporal cortex and hippocampus compared with controls. A remitting course was related to reversal of baseline temporal grey matter deficits. Conclusions. Our findings do not support the hypothesis of brain changes indicating a progressive course in the initial phase of psychosis. Rather, some brain volume abnormalities may be reversible, possibly associated with a better illness course.

Regional gray matter abnormalities in panic disorder: A voxel-based morphometry study

Although abnonnalities in brain structures involved in the neurobiology of fear and anxiety have been implicated in the pathophysiology of panic disorder (PD), relatively few studies have made use of voxel-based morphometry (VBM) magnetic resonance imaging (MRI) to determine structural brain abnormalities in PD. We have assessed gray matter volume in 19 PD patients and 20 healthy volunteers using VBM. Images were acquired using a 1.5 T MRI scanner, and were spatially normalized and segmented using optimized VBM. Statistical comparisons were performed using the general linear model. A relative increase in gay matter volume was found in the left insula of PD patients compared with controls. Additional structures showing differential increases were the left superior temporal gyrus, the midbrain, and the pons. A relative gray matter deficit was found in the right anterior cingulate cortex. The insula and anterior cingulate abnormalities may be relevant to the pathophysiology of PD, since these structures participate in the evaluation process that ascribes negative emotional meaning to potentially distressing cognitive and interoceptive sensory information. The abnormal brain stem structures may be involved in the generation of panic attacks. (C) 2007 Elsevier Ireland Ltd. All rights reserved.

Cytogenetic and Molecular Evaluation and 20-Year Follow-Up of a Patient With Ring Chromosome 14

We present a 20-year follow-up on a patient with a ring chromosome 14. The ring chromosome was studied by fluorescence in-situ hybridization (FISH), multiplex-ligation probe amplification (MLPA), and genome wide SNP array, and no deletions of chromosome 14 were detected, although the telomeric repeat sequence was absent from the ring chromosome. The patient had skeletal abnormalities, and susceptibility to infections, as well as seizures and retinal pigmentation, which are commonly found in individuals with a ring 14. Our patient corroborates the idea that even when no genes are lost during ring formation, a complete ring chromosome can produce phenotypic alterations, which presumably result from ring instability or gene silencing due to the new chromosomal architecture. (C) 2010 Wiley-Liss, Inc.

Extending the Phenotype of Monosomy 1p36 Syndrome and Mapping of a Critical Region for Obesity and Hyperphagia

Rearrangements of 1p36 are the most frequently detected abnormalities in diagnostic testing for chromosomal cryptic imbalances and include variably sized simple terminal deletions, derivative chromosomes, interstitial deletions, and complex rearrangements. These rearrangements result in the specific pattern of malformation and neurodevelopmental disabilities that characterizes monosomy 1p36 syndrome. Thus far, no individual gene within this region has been conclusively determined to be causative of any component of the phenotype. Nor is it known if the rearrangements convey phenotypes via a haploinsufficiency mechanism or through a position effect. We have used multiplex ligation-dependent probe amplification to screen for deletions of 1p36 in a group of 154 hyperphagic and overweight/obese, PWS negative individuals, and in a separate group of 83 patients initially sent to investigate a variety of other conditions. The strategy allowed the identification and delineation of rearrangements in nine subjects with a wide spectrum of clinical presentations. Our work reinforces the association of monosomy 1p36 and obesity and hyperphagia, and further suggests that these features may be associated with non-classical manifestations of this disorder in addition to a submicroscopic deletion of similar to 2-3 Mb in size. Multiplex ligation probe amplification using the monosomy 1p36 syndrome-specific kit coupled to the subtelomeric kit is an effective approach to identify and delineate rearrangements at 1p36. (C) 2009 Wiley-Liss, Inc.

Neuronal Correlates of Brain-derived Neurotrophic Factor Val66Met Polymorphism and Morphometric Abnormalities in Bipolar Disorder

The brain-derived neurotrophic factor (BDNF) Val66Met polymorphism has been proposed as a possible candidate for involvement in the pathophysiology of bipolar disorder ( BD). To determine whether an association exists between the BDNF Val66Met genotype and morphometric abnormalities of the brain regions involved in memory and learning in BD and healthy subjects. Forty-two BD patients and 42 healthy subjects were studied. Interactions between BDNF Val66Met genotype and diagnosis in gray ( GM) volumes were analyzed using an optimized voxel-based morphometry technique. Declarative memory function was assessed with the California Verbal Learning Test II. Left and right anterior cingulate GM volumes showed a significant interaction between genotype and diagnosis such that anterior cingulate GM volumes were significantly smaller in the Val/Met BD patients compared with the Val/Val BD patients (left P = 0.01, right P = 0.01). Within-group comparisons revealed that the Val/Met carriers showed smaller GM volumes of the dorsolateral prefrontal cortex compared with the Val/Val subjects within the BD patient (P = 0.01) and healthy groups (left P = 0.03, right P = 0.03). The Val/Met healthy subjects had smaller GM volumes of the left hippocampus compared with the Val/Val healthy subjects (P<0.01). There was a significant main effect of diagnosis on memory function (P = 0.04), but no interaction between diagnosis and genotype was found (P = 0.48). The findings support an association between the BDNF Val66Met genotype and differential gray matter content in brain structures, and suggest that the variation in this gene may play a more prominent role in brain structure differences in subjects affected with BD. Neuropsychopharmacology (2009) 34, 1904-1913; doi: 10.1038/npp.2009.23; published online 18 March 2009