989 resultados para (Gtg)5-pcr


Relevância:

30.00% 30.00%

Publicador:

Resumo:

A total of 301 cell cultures from 15 laboratories were monitored for mycoplasma (Mollicutes) using PCR and culture methodology. The infection was detected in the cell culture collection of 12 laboratories. PCR for Mollicutes detected these bacteria in 93 (30.9%) samples. Although the infection was confirmed by culture for 69 (22.9%) samples, PCR with generic primers did not detect the infection in five (5.4%). Mycoplasma species were identified with specific primers in 91 (30.2%) of the 98 samples (32.6%) considered to be infected. Mycoplasma hyorhinis was detected in 63.3% of the infected samples, M. arginini in 59.2%, Acholeplasma laidlawii in 20.4%, M. fermentans in 14.3%, M. orale in 11.2%, and M. salivarium in 8.2%. Sixty (61.2%) samples were co-infected with more than one mycoplasma species. M. hyorhinis and M. arginini were the microorganisms most frequently found in combination, having been detected in 30 (30.6%) samples and other associations including up to four species were detected in 30 other samples. Failure of the treatments used to eliminate mycoplasmas from cell cultures might be explained by the occurrence of these multiple infections. The present results indicate that the sharing of non-certified cells among laboratories may disseminate mycoplasma in cell cultures.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Apolipoprotein CIII (apo-CIII) participates in the regulation of triglyceride-rich lipoprotein metabolism. Several polymorphic sites have been detected within and around the apo-CIII gene. Here, we examined the relationship between apo-CIII SstI polymorphism (CC, CG, GG genotypes) and plasma triglyceride (TG) levels in a group of 159 Japanese individuals living in Southern Brazil. The sample was divided into a group of Japanese descendants (N = 51) with high TG (HTG; >200 mg/dL) and a group of Japanese descendants (N = 108) with normal TG (NTG; <200 mg/dL). TG and total cholesterol levels were analyzed by an enzymatic method using the Labtest-Diagnostic kit and high- and low-density lipoproteins by a direct method using the Labtest-Diagnostic kit and DiaSys Diagnostic System International kit, respectively. A 428-bp sequence of apo-CIII gene was amplified using oligonucleotide primers 5' GGT GAC CGA TGG CTT CAG TTC CCT GA 3' and 5' CAG AAG GTG GAT AGA GCG CTG GCC T 3'. The PCR products were digested with a restriction endonuclease SstI. Rare G allele was highly prevalent in our study population (0.416) compared to Caucasians (0.00-0.11). G allele was almost two times more prevalent in the HTG group compared to the NTG group (P < 0.001). The genotype distribution was consistent with the Hardy-Weinberg equilibrium. There was a significant association between rare G allele and HTG in Japanese individuals living in Southern Brazil as indicated by one-way ANOVA, P < 0.05.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Bovine herpesvirus type 5 (BoHV-5) is an important pathogen of cattle in South America. We describe here the construction and characterization of deletion mutants defective in the glycoprotein E (gE) or thymidine kinase (TK) gene or both (gE/TK) from a highly neurovirulent and well-characterized Brazilian BoHV-5 strain (SV507/99). A gE-deleted recombinant virus (BoHV-5 gE∆) was first generated in which the entire gE open reading frame was replaced with a chimeric green fluorescent protein gene. A TK-deleted recombinant virus (BoHV-5 TK∆) was then generated in which most of the TK open reading frame sequences were deleted and replaced with a chimeric β-galactosidase gene. Subsequently, using the BoHV-5 gE∆ virus as backbone, a double gene-deleted (TK plus gE) BoHV-5 recombinant (BoHV-5 gE/TK∆) was generated. The deletion of the gE and TK genes was confirmed by immunoblotting and PCR, respectively. In Madin Darby bovine kidney (MDBK) cells, the mutants lacking gE (BoHV-5 gE∆) and TK + gE (BoHV-5 gE/TK∆) produced small plaques while the TK-deleted BoHV-5 produced wild-type-sized plaques. The growth kinetics and virus yields in MDBK cells for all three recombinants (BoHV-5 gE∆, BoHV-5 TK∆ and BoHV-5 gE/TK∆) were similar to those of the parental virus. It is our belief that the dual gene-deleted recombinant (BoHV-5 gE/TK∆) produced on the background of a highly neurovirulent Brazilian BoHV-5 strain may have potential application in a vaccine against BoHV-5.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In addition to methylated cytosines (5-mCs), hydroxymethylcytosines (5-hmCs) are present in CpG dinucleotide-enriched regions and some transcription regulator binding sites. Unlike methylation, hydroxymethylation does not result in silencing of gene expression, and the most commonly used methods to study methylation, such as techniques based on restriction enzymatic digestion and/or bisulfite modification, are unable to distinguish between them. Genomic imprinting is a process of gene regulation where only one member of an allelic pair is expressed depending on the parental origin. Chromosome 11p15.5 has an imprinting control region (ICR2) that includes a differentially methylated region (KvDMR1) that guarantees parent-specific gene expression. The objective of the present study was to determine the presence of 5-hmC at the KvDMR1 in human placentas. We analyzed 16 third-trimester normal human placentas (chorionic villi). We compared two different methods based on real-time PCR after enzymatic digestion. The first method distinguished methylation from hydroxymethylation, while the other method did not. Unlike other methylation studies, subtle variations of methylation in ICRs could represent a drastic deregulation of the expression of imprinted genes, leading to important phenotypic consequences, and the presence of hydroxymethylation could interfere with the results of many studies. We observed agreement between the results of both methods, indicating the absence of hydroxymethylation at the KvDMR1 in third-trimester placentas. To the best of our knowledge, this is the first study describing the investigation of hydroxymethylation in human placenta using a genomic imprinting model.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are granulomatous disorders with similar clinical manifestations and pathological features that are often difficult to differentiate. This study evaluated the value of fluorescent quantitative polymerase chain reaction (FQ-PCR) for Mycobacterium tuberculosis (MTB) in fecal samples and biopsy specimens to differentiate ITB from CD. From June 2010 to March 2013, 86 consecutive patients (38 females and 48 males, median age 31.3 years) with provisional diagnoses of ITB and CD were recruited for the study. The patients' clinical, endoscopic, and histological features were monitored until the final definite diagnoses were made. DNA was extracted from 250 mg fecal samples and biopsy tissues from each patient. The extracted DNA was amplified using FQ-PCR for the specific MTB sequence. A total of 29 ITB cases and 36 CD cases were included in the analysis. Perianal disease and longitudinal ulcers were significantly more common in the CD patients (P<0.05), whereas night sweats, ascites, and circumferential ulcers were significantly more common in the ITB patients (P<0.05). Fecal FQ-PCR for MTB was positive in 24 (82.8%) ITB patients and 3 (8.3%) CD patients. Tissue PCR was positive for MTB in 16 (55.2%) ITB patients and 2 (5.6%) CD patients. Compared with tissue FQ-PCR, fecal FQ-PCR was more sensitive (X2=5.16, P=0.02). We conclude that FQ-PCR for MTB on fecal and tissue samples is a valuable assay for differentiating ITB from CD, and fecal FQ-PCR has greater sensitivity for ITB than tissue FQ-PCR.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Reversion-inducing cysteine-rich protein with kazal motifs (RECK), a novel tumor suppressor gene that negatively regulates matrix metalloproteinases (MMPs), is expressed in various normal human tissues but downregulated in several types of human tumors. The molecular mechanism for this downregulation and its biological significance in salivary adenoid cystic carcinoma (SACC) are unclear. In the present study, we investigated the effects of a DNA methyltransferase (DNMT) inhibitor, 5-aza-2′deoxycytidine (5-aza-dC), on the methylation status of the RECK gene and tumor invasion in SACC cell lines. Methylation-specific PCR (MSP), Western blot analysis, and quantitative real-time PCR were used to investigate the methylation status of the RECK gene and expression of RECK mRNA and protein in SACC cell lines. The invasive ability of SACC cells was examined by the Transwell migration assay. Promoter methylation was only found in the ACC-M cell line. Treatment of ACC-M cells with 5-aza-dC partially reversed the hypermethylation status of the RECK gene and significantly enhanced the expression of mRNA and protein, and 5-aza-dC significantly suppressed ACC-M cell invasive ability. Our findings showed that 5-aza-dC inhibited cancer cell invasion through the reversal of RECKgene hypermethylation, which might be a promising chemotherapy approach in SACC treatment.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Salmonelose é a infecção bacteriana de origem alimentar mais freqüente no Paraná, Brasil, e os surtos estão associados, principalmente, ao consumo de ovos, carne de aves e derivados. Os objetivos deste trabalho foram identificar os sorovares de Salmonella isolados de carcaças de frango e caracterizá-los molecularmente por REP e ERIC-PCR, assim como identificar os fagotipos de Salmonella Enteriditis. Dos 25 isolados de Salmonella spp. analisados, 18 foram identificados como Enteriditis, 4 como Braenderup, 2 como Worthington e 1 como infantis. Dos 18 isolados de Enteriditis, 14 foram PT4, 2 PT4a, 1 PT7 e 1 RDNC, por se tratar de colônia rugosa. REP-PCR forneceu padrão eletroforético distinto de 10 a 13 bandas distribuídas entre 120 e 2072 pb para cada sorovar diferente testado. A ERIC-PCR mostrou um padrão de 4 a 5 bandas entre 180 e 1000 pb e foi menos discriminativa quando comparada à REP-PCR. Os resultados encontrados confirmaram que a fagotipagem é uma ferramenta útil e discriminativa para o sorovar Enteriditis. Apesar do pequeno número de sorovares testados, os resultados sugerem que a REP-PCR parece ser um método atrativo a ser utilizado no futuro para a discriminação preliminar de sorovares de Salmonella.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R²) demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct) values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Tesis (Maestría en Ciencias con Especialidad en Morfología) UANL

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Tesis (Maestría en Ciencias con Especialidad en Entomología Médica) UANL