915 resultados para Interstitial telomeric sequence


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Vaccinia virus is a complex DNA virus that exhibits significant genetic and physical autonomy from the host cell. Most if not all of the functions involved in replication and transcription of the 192-kb genome are virally encoded. Although significant progress has been made in identifying trans-acting factors involved in DNA synthesis, the mechanism of genome replication has remained poorly understood. The genome is a linear duplex with covalently closed hairpin termini, and it has been presumed that sequences and/or structures within these termini are important for the initiation of genome replication. In this report we describe the construction of minichromosomes containing a central plasmid insert flanked by hairpin termini derived from the viral genome and their use as replication templates. When replication of these minichromosomes was compared with a control substrate containing synthetic hairpin termini, specificity for viral telomeres was apparent. Inclusion of > or = 200 bp from the viral telomere was sufficient to confer optimal replication efficiency, whereas 65-bp telomeres were not effective. Chimeric 200-bp telomeres containing the 65-bp terminal element and 135 bp of ectopic sequence also failed to confer efficient replication, providing additional evidence that telomere function is sequence-specific. Replication of these exogenous templates was dependent upon the viral replication machinery, was temporally coincident with viral replication, and generated covalently closed minichromosome products. These data provide compelling evidence for specificity in template recognition and utilization in vaccinia virus-infected cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Molossidae species, Cynomops abrasus (2n = 34, fundamental number, FN = 64), Eumops auripendulus (2n = 42, FN = 62), Molossus rufus (2n = 48, FN = 64), Molossops temminckii (2n = 48, FN = 64), and Nyctinomops laticaudatus (2n = 48, FN = 64), and Phyllostomidae species, Phyllostomus discolor (2n = 32, FN = 60), have karyotypes with different chromosome and fundamental numbers, different localization of constitutive heterochromatin, and different numbers and location of nucleolar organizer regions (NORs). Fluorescence in situ hybridization with a human probe of the telomeric sequence (TTAGGG)n produced fluorescent signals in telomeric regions of the six bat species' chromosomes; in E. auripendulus, pericentromeric signals were also observed in the acrocentric and subtelocentric chromosomes. A relationship between telomeric sequences and NORs, and between telomeric sequences and constitutive heterochromatin was detected in chromosomes bearing NORs in C. abrasus, M. temminckii, N. laticaudatus, and P. discolor. No interstitial signal was observed in the meta- or submetacentric chromosomes of these species. ©FUNPEC-RP.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The location of chromosomal telomeric repeats (TTAGGG)(n) was investigated in two species of the Molossidae family, Eumops glaucinus and Eumops perotis. The diploid chromosome number (2n) is 40 in E. glaucinus and 48 in E. perotis and the fundamental numbers (FN) are 64 and 58, respectively. It has been suggested that the E. glaucinus karyotype has evolved from the E. perotis karyotype through Robertsonian fusion events. In the present study, the telomeric sequences were detected at the termini of chromosomes in both species. In addition, E. glaucinus also displayed telomeric repeats in centromeric and pericentromeric regions in almost all biarmed chromosomes. Conversely, in E. perotis pericentromeric signals were only observed in two biarmed chromosomes. In both E. glaucinus and E. perotis, such telomeric sequences were observed as part of the heterochromatin. The interstitial sites of telomeric sequences suggest that they are remnants of telomeres of ancestral chromosomes that participated in the fusion event.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

90.00% 90.00%

Publicador:

Resumo:

As análises citogenéticas de diversos Falconiformes mostraram que os acipitrídeos têm uma organização cromossômica atípica na classe Aves, com um número diplóide relativamente baixo (média de 2n= 66) e poucos pares de microcromossomos (4 a 6 pares). Propostas baseadas em citogenética clássica sugeriram que esse fato devia-se à fusão de microcromossomos presentes no cariótipo ancestral das Aves. No intuito de contribuir para o esclarecimento das questões referentes à evolução cromossômica e filogenética dessa família, três espécies da subfamília Buteoninae (Rupornis magnirostris, Buteogallus meridionales e Asturina nitida) e duas espécies da subfamília Harpiinae (Harpia harpyja e Morphnus guianensis) foram analisados citogeneticamente através da aplicação de técnicas de citogenética clássica e molecular. As espécies de Buteoninae apresentaram cariótipos muito semelhantes, com número diplóide igual a 68; o número de cromossomos de dois braços entre 17 e 21, o cromossomo Z submetacêntrico e o W metacêntrico em R. magnirostris e submetacêntrico em Asturina nitida. O uso de sondas de 18/28S rDNA mostrou a localização de regiões organizadoras de nucléolo em um par submetacêntrico médio nas três espécies, correspondendo ao braço curto do par 7. Sequências teloméricas foram mapeadas não só na região terminal dos braços, mas também em algumas posições intersticiais. Sondas de cromossomo inteiro derivadas dos pares 1 a 10 de Gallus gallus (GGA) produziram o mesmo número de sinais nessas três espécies. A disponibilidade das sondas de cromossomos totais derivadas de Leucopternis albicollis confirmou a existência de uma assinatura citogenética comum para as espécies de Buteoninae analisadas por FISH, que se trata da associação entre GGA1p e GGA6, inclusive com um sítio de sequência telomérica intersticial reforçando esse fato. As espécies de Harpiinae analisadas mostraram que o número diplóide das espécies de H. harpyja e M. guianensis foi igual a 58 e 54, respectivamente, e que ambas as espécies apresentam vinte e dois pares de cromossomos de dois braços, mesmo Harpia apresentando dois pares a mais. 18/28S rDNA produziram sinais no braço curto do par 1 em M. guianensis e em dois pares em H. harpyja (pares 6 e 25). Sequências teloméricas intersticiais também foram observadas em alguns pares. Apesar da similaridade na morfologia cromossômica, não foram observadas associações compartilhadas por essas duas espécies. As diferentes associações observadas em Morphnus e Harpia mostram que essas espécies sofreram uma reorganização genômica expressiva após sua separação em linhagens independentes. Além disso, ausência de associações semelhantes sugere que houve fissões nos macrocromossomos do ancestral em comum desse grupo, e as fusões foram subsequentes ao seu isolamento como linhagens diferentes. Os resultados aqui apresentados, somados àqueles publicados anteriormente com outras espécies de Accipitridae indicam que os processos de fissões envolvendo os macrocromossomos de GGA e fusões entre esses segmentos e entre esses e microcromossomos são rearranjos recorrentes nesse grupo. Apesar dos Falconidae também apresentarem cariótipos atípicos, e números diploides baixos, os dados globais da citogenética de Accipitridae indicam que, assim como postulado para as semelhanças morfológicas entre esses dois grupos, os cariótipos rearranjados corresponderiam a homoplasias, do ponto de vista evolutivo, apoiando que essas duas famílias não formam um grupo monofilético.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Blarinomys breviceps possesses cryptic and burrowing habits with poorly documented genetics and life history traits. Due to its rarity, only a few specimens and DNA sequences have been deposited in collections worldwide. Here, we present the most comprehensive cytogenetic and molecular characterization of this rare genus. Phylogenetic analyses based on partial cytochrome b sequences were performed, attempting to establish the relationships among individuals with distinct karyotypes along the geographic distribution of the genus in the Atlantic Forest. Classical and molecular cytogenetics, using banding patterns and FISH of telomeric and whole chromosome X-specific painting probes (obtained from the Akodontini Akodon cursor) were used to characterize and compare the chromosomal complements. Molecular phylogenetic analyses recovered 2 main geographically structured clades, northeastern and southeastern with pair-wise sequence divergences among specimens varying between 4.9 and 8.4%. Eight distinct karyomorphs are described: (A) 2n = 52 (50A, XX), (B) 2n = 52 (48A, XY+2Bs), (C) 2n = 45 (42A, XY+1B), (D) 2n = 43 (37A, XX+4Bs), (E) 2n = 37 (34A, XY+1B), (F) 2n = 34 (32A, XX), (G) 2n = 31 (27A, XX+2Bs), (H) 2n = 28 (26A, XY), all with the same number of autosomal arms (FNA = 50). Variation of 0-4 supernumerary chromosomes (Bs) presenting heterogeneity in morphology and distribution of interstitial telomeric sequences (ITSs) is reported. ITSs are also found in some metacentric autosomes. The phylogeographic separation between 2 major lineages with high levels of genetic divergence, and the wide karyotypic diversity indicate that B. breviceps is a diverse group that warrants taxonomic re-evaluation. Copyright (C) 2012 S. Karger AG, Basel

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Cichlids are important in the aquaculture and ornamental fish trade and are considered models for evolutionary biology. However, most studies of cichlids have investigated African species, and the South American cichlids remain poorly characterized. Studies in neotropical regions have focused almost exclusively on classical cytogenetic approaches without investigating physical chromosomal mapping of specific sequences. The aim of the present study is to investigate the genomic organization of species belonging to different tribes of the subfamily Cichlinae (Cichla monoculus, Astronotus ocellatus, Geophagus proximus, Acaronia nassa, Bujurquina peregrinabunda, Hoplarchus psittacus, Hypselecara coryphaenoides, Hypselecara temporalis, Caquetaia spectabilis, Uaru amphiacanthoides, Pterophyllum leopoldi, Pterophyllum scalare, and Symphysodon discus) and reexamine the karyotypic evolutionary patterns proposed for this group. Variations in some cytogenetic markers were observed, although no trends were found in terms of the increase, decrease, or maintenance of the basal diploid chromosome number 2n = 48 in the tribes. Several species were observed to have 18S rDNA genetic duplications, as well as multiple rDNA loci. In most of the taxa analyzed, the 5S rDNA was located in the interstitial region of a pair of homologous chromosomes, although variations from this pattern were observed. Interstitial telomere sites were also observed and appear to be involved in chromosomal rearrangement events and the accumulation of repeat-rich satellite DNA sequences. Our data demonstrated the karyotypic diversity that exists among neotropical cichlids, suggesting that most of this diversity is due to the repetitive sequences present in heterochromatic regions and that repeat sequences have greatly influenced the karyotypic evolution of these fishes. © 2012 Springer Science+Business Media B.V.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The recently described taxon Drymoreomys albimaculatus is endemic to the Brazilian Atlantic Forest and its biology and genetics are still poorly known. Herein, we present, for the first time, the karyotype of the species using classical and molecular cytogenetics, which showed 2n=62, FN=62, and interstitial telomeric signals at the sex chromosomes. Nuclear and mitochondrial DNA sequences from the two karyotyped individuals verify the taxonomic identity as the recently described D. albimaculatus and confirm the relationship of the species with other Oryzomyini. Additionally, external morphological information is provided. © Elkin Y. Suárez-Villota et al.