Relação entre a biomecânica e a hidratação cutâneas em indivíduos normoponderais e influência da idade

A pele constitui o maior órgão do corpo humano. As diversas funções cutâneas que conhecemos reúnem-se na sua capacidade de protecção e de adaptação ao contorno corporal. O presente estudo visa comparar parâmetros de hidratação e elasticidade, de forma a determinar de que forma uma poderá influenciar ou ser influenciada pela outra. Para tal, foi selecionada uma amostra de conveniência de 42 voluntárias, do sexo feminino, saudáveis e normoponderais (de acordo com a classificação internacional da OMS). Afunção “barreira” da pele foi caracterizada pela perda transepidérmica de água (Tewameter TM300); a hidratação superficial foi medida através da utilização do Moisturemeter SC e Corneometer; e a função “envelope” foi medida através da utilização do Cutometer MPA580 e Reviscometer RV600. As medições foram efetuadas na face (zona zigomática e fronte), na mama e no abdómen. Os resultados mais significativos demonstram uma influência da idade na alteração dos diversos parâmetros avaliados, de acordo com o que se encontra publicados. Para além disso, parece existir alguma relação entre os parâmetros de hidratação e alguns descritores biomecânicos, a qual deverá ser investigada em estudos futuros.

Estudos conformocionais de diversas proteínas em solução utilizando a técnica de espalhamento de raios-X à baixo ângulo-saxs

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Subband energy in two-band δ-doped semiconductors

We study electron dynamics in a two-band δ-doped semiconductor within the envelope-function approximation. Using a simple parametrization of the confining potential arising from the ionized donors in the δ -doping layer, we are able to find exact solutions of the Dirac-type equation describing the coupling of host bands. As an application we then consider Si δ -doped GaAs. In particular we find that the ground subband energy scales as a power law of the Si concentration per unit area in a wide range of doping levels. In addition, the coupling of host bands leads to a depression of the subband energy due to nonparabolicity effects.

Terahertz Response of Excitons in Nanorod Heterostructures

Quantum-confined systems are one of the most promising ways to enable us to control a material's interactions with light. Nanorods in particular offer the right dimensions for exploring and manipulating the terahertz region of the spectrum. In this thesis, we model excitons confined inside a nanorod using the envelope function approximation. A region-matching transfer matrix method allows us to simulate excitonic states inside arbitrary heterostructures grown along the length of the rod. We apply the method to colloidal CdSe rods 70 nm in length and under 10 nm in diameter, capped with ligands of DDPA and pyridine. We extend past studies on these types of rods by taking into account their dielectric permittivity mismatch. Compared to previous calculations and experimentally measured terahertz absorption, we predict a higher energy main 1S$z$ to 2P$z$ transition peak. This indicates that the rods are likely larger in diameter than previously thought. We also investigate a nanorod with GaAs/Al$_{0.3}$Ga$_{0.7}$As coupled double dots. The excitonic transitions were found to be manipulable by varying the strength of an applied electric field. We employ quasi-static state population distributions to simulate the effects of exciton relaxation from optically active states to dim ground states. A critical value of the applied field, corresponding to the exciton binding energy of ~18 meV, was found to dramatically alter the terahertz absorption due to state mixing. Above this critical field, more nuanced shifts in transition energies were observed, and gain from radiative relaxation to the ground state is predicted.

Contribution of redox status to hepatitis C virus E2 envelope protein function and antigenicity

Disulfide bonding contributes to the function and antigenicity of many viral envelope glycoproteins. We assessed here its significance for the hepatitis C virus E2 envelope protein and a counterpart deleted for hypervariable region-1 (HVR1). All 18 cysteine residues of the antigens were involved in disulfides. Chemical reduction of up to half of these disulfides was compatible with anti-E2 monoclonal antibody reaction, CD81 receptor binding, and viral entry, whereas complete reduction abrogated these properties. The addition of 5,5'-dithiobis-2-nitrobenzoic acid had no effect on viral entry. Thus, E2 function is only weakly dependent on its redox status, and cell entry does not require redox catalysts, in contrast to a number of enveloped viruses. Because E2 is a major neutralizing antibody target, we examined the effect of disulfide bonding on E2 antigenicity. We show that reduction of three disulfides, as well as deletion of HVR1, improved antibody binding for half of the patient sera tested, whereas it had no effect on the remainder. Small scale immunization of mice with reduced E2 antigens greatly improved serum reactivity with reduced forms of E2 when compared with immunization using native E2, whereas deletion of HVR1 only marginally affected the ability of the serum to bind the redox intermediates. Immunization with reduced E2 also showed an improved neutralizing antibody response, suggesting that potential epitopes are masked on the disulfide-bonded antigen and that mild reduction may increase the breadth of the antibody response. Although E2 function is surprisingly independent of its redox status, its disulfide bonds mask antigenic domains. E2 redox manipulation may contribute to improved vaccine design.

The Role of the Humoral Immune Response in the Molecular Evolution of the Envelope C2, V3 and C3 Regions in Chronically HIV-2 Infected Patients

BACKGROUND: This study was designed to investigate, for the first time, the short-term molecular evolution of the HIV-2 C2, V3 and C3 envelope regions and its association with the immune response. Clonal sequences of the env C2V3C3 region were obtained from a cohort of eighteen HIV-2 chronically infected patients followed prospectively during 2-4 years. Genetic diversity, divergence, positive selection and glycosylation in the C2V3C3 region were analysed as a function of the number of CD4+ T cells and the anti-C2V3C3 IgG and IgA antibody reactivity RESULTS: The mean intra-host nucleotide diversity was 2.1% (SD, 1.1%), increasing along the course of infection in most patients. Diversity at the amino acid level was significantly lower for the V3 region and higher for the C2 region. The average divergence rate was 0.014 substitutions/site/year, which is similar to that reported in chronic HIV-1 infection. The number and position of positively selected sites was highly variable, except for codons 267 and 270 in C2 that were under strong and persistent positive selection in most patients. N-glycosylation sites located in C2 and V3 were conserved in all patients along the course of infection. Intra-host variation of C2V3C3-specific IgG response over time was inversely associated with the variation in nucleotide and amino acid diversity of the C2V3C3 region. Variation of the C2V3C3-specific IgA response was inversely associated with variation in the number of N-glycosylation sites. CONCLUSION: The evolutionary dynamics of HIV-2 envelope during chronic aviremic infection is similar to HIV-1 implying that the virus should be actively replicating in cellular compartments. Convergent evolution of N-glycosylation in C2 and V3, and the limited diversification of V3, indicates that there are important functional constraints to the potential diversity of the HIV-2 envelope. C2V3C3-specific IgG antibodies are effective at reducing viral population size limiting the number of virus escape mutants. The C3 region seems to be a target for IgA antibodies and increasing N-linked glycosylation may prevent HIV-2 envelope recognition by these antibodies. Our results provide new insights into the biology of HIV-2 and its relation with the human host and may have important implications for vaccine design.

Regulation and function of the cell wall polymer lipoteichoic acid in staphylococcus aureus

A thesis submitted for the Degree of Master in Medical microbiology

A General and Intuitive Envelope Theorem

We present an envelope theorem for establishing first-order conditions in decision problems involving continuous and discrete choices. Our theorem accommodates general dynamic programming problems, even with unbounded marginal utilities. And, unlike classical envelope theorems that focus only on differentiating value functions, we accommodate other endogenous functions such as default probabilities and interest rates. Our main technical ingredient is how we establish the differentiability of a function at a point: we sandwich the function between two differentiable functions from above and below. Our theory is widely applicable. In unsecured credit models, neither interest rates nor continuation values are globally differentiable. Nevertheless, we establish an Euler equation involving marginal prices and values. In adjustment cost models, we show that first-order conditions apply universally, even if optimal policies are not (S,s). Finally, we incorporate indivisible choices into a classic dynamic insurance analysis.

Hepatitis C virus proteins: from structure to function.

Great progress has been made over the past years in elucidating the structure and function of the hepatitis C virus (HCV) proteins, most of which are now actively being pursued as antiviral targets. The structural proteins, which form the viral particle, include the core protein and the envelope glycoproteins E1 and E2. The nonstructural proteins include the p7 viroporin, the NS2 protease, the NS3-4A complex harboring protease and NTPase/RNA helicase activities, the NS4B and NS5A proteins, and the NS5B RNA-dependent RNA polymerase. NS4B is a master organizer of replication complex formation while NS5A is a zinc-containing phosphoprotein involved in the regulation of HCV RNA replication versus particle production. Core to NS2 make up the assembly module while NS3 to NS5B represent the replication module (replicase). However, HCV proteins exert multiple functions during the viral life cycle, and these may be governed by different structural conformations and/or interactions with viral and/or cellular partners. Remarkably, each viral protein is anchored to intracellular membranes via specific determinants that are essential to protein function in the cell. This review summarizes current knowledge of the structure and function of the HCV proteins and highlights recent advances in the field.

FtsZ-independent septal recruitment and function of cell wall remodelling enzymes in chlamydial pathogens.

The nature and assembly of the chlamydial division septum is poorly defined due to the paucity of a detectable peptidoglycan (PG)-based cell wall, the inhibition of constriction by penicillin and the presence of coding sequences for cell wall precursor and remodelling enzymes in the reduced chlamydial (pan-)genome. Here we show that the chlamydial amidase (AmiA) is active and remodels PG in Escherichia coli. Moreover, forward genetics using an E. coli amidase mutant as entry point reveals that the chlamydial LysM-domain protein NlpD is active in an E. coli reporter strain for PG endopeptidase activity (ΔnlpI). Immunolocalization unveils NlpD as the first septal (cell-wall-binding) protein in Chlamydiae and we show that its septal sequestration depends on prior cell wall synthesis. Since AmiA assembles into peripheral clusters, trimming of a PG-like polymer or precursors occurs throughout the chlamydial envelope, while NlpD targets PG-like peptide crosslinks at the chlamydial septum during constriction.

Differential Recognition of Old World and New World Arenavirus Envelope Glycoproteins by Subtilisin Kexin Isozyme 1 (SKI-1)/Site 1 Protease (S1P).

The arenaviruses are an important family of emerging viruses that includes several causative agents of severe hemorrhagic fevers in humans that represent serious public health problems. A crucial step of the arenavirus life cycle is maturation of the envelope glycoprotein precursor (GPC) by the cellular subtilisin kexin isozyme 1 (SKI-1)/site 1 protease (S1P). Comparison of the currently known sequences of arenavirus GPCs revealed the presence of a highly conserved aromatic residue at position P7 relative to the SKI-1/S1P cleavage side in Old World and clade C New World arenaviruses but not in New World viruses of clades A and B or cellular substrates of SKI-1/S1P. Using a combination of molecular modeling and structure-function analysis, we found that residueY285 of SKI-1/S1P, distal from the catalytic triad, is implicated in the molecular recognition of the aromatic "signature residue" at P7 in the GPC of Old World Lassa virus. Using a quantitative biochemical approach, we show that Y285 of SKI-1/S1P is crucial for the efficient processing of peptides derived from Old World and clade C New World arenavirus GPCs but not of those from clade A and B New World arenavirus GPCs. The data suggest that during coevolution with their mammalian hosts, GPCs of Old World and clade C New World viruses expanded the molecular contacts with SKI-1/S1P beyond the classical four-amino-acid recognition sequences and currently occupy an extended binding pocket.

Nrf2 links epidermal barrier function with antioxidant defense.

The skin provides an efficient permeability barrier and protects from microbial invasion and oxidative stress. Here, we show that these essential functions are linked through the Nrf2 transcription factor. To test the hypothesis that activation of Nrf2 provides skin protection under stress conditions, we determined the consequences of pharmacological or genetic activation of Nrf2 in keratinocytes. Surprisingly, mice with enhanced Nrf2 activity in keratinocytes developed epidermal thickening, hyperkeratosis and inflammation resembling lamellar ichthyosis. This resulted from upregulation of the cornified envelope proteins small proline-rich proteins (Sprr) 2d and 2h and of secretory leukocyte peptidase inhibitor (Slpi), which we identified as novel Nrf2 targets in keratinocytes. Since Sprrs are potent scavengers of reactive oxygen species and since Slpi has antimicrobial activities, their upregulation contributes to Nrf2's protective function. However, it also caused corneocyte fragility and impaired desquamation, followed by alterations in the epidermal lipid barrier, inflammation and overexpression of mitogens that induced keratinocyte hyperproliferation. These results identify an unexpected role of Nrf2 in epidermal barrier function, which needs to be considered for pharmacological use of Nrf2 activators.

Molecular characterization of the processing of arenavirus envelope glycoprotein precursors by subtilisin kexin isozyme-1/site-1 protease.

A crucial step in the life cycle of arenaviruses is the biosynthesis of the mature fusion-active viral envelope glycoprotein (GP) that is essential for virus-host cell attachment and entry. The maturation of the arenavirus GP precursor (GPC) critically depends on proteolytic processing by the cellular proprotein convertase (PC) subtilisin kexin isozyme-1 (SKI-1)/site-1 protease (S1P). Here we undertook a molecular characterization of the SKI-1/S1P processing of the GPCs of the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV) and the pathogenic Lassa virus (LASV). Previous studies showed that the GPC of LASV undergoes processing in the endoplasmic reticulum (ER)/cis-Golgi compartment, whereas the LCMV GPC is cleaved in a late Golgi compartment. Herein we confirm these findings and provide evidence that the SKI-1/S1P recognition site RRLL, present in the SKI-1/S1P prodomain and LASV GPC, but not in the LCMV GPC, is crucial for the processing of the LASV GPC in the ER/cis-Golgi compartment. Our structure-function analysis revealed that the cleavage of arenavirus GPCs, but not cellular substrates, critically depends on the autoprocessing of SKI-1/S1P, suggesting differences in the processing of cellular and viral substrates. Deletion mutagenesis showed that the transmembrane and intracellular domains of SKI-1/S1P are dispensable for arenavirus GPC processing. The expression of a soluble form of the protease in SKI-I/S1P-deficient cells resulted in the efficient processing of arenavirus GPCs and rescued productive virus infection. However, exogenous soluble SKI-1/S1P was unable to process LCMV and LASV GPCs displayed at the surface of SKI-I/S1P-deficient cells, indicating that GPC processing occurs in an intracellular compartment. In sum, our study reveals important differences in the SKI-1/S1P processing of viral and cellular substrates.

Amplitude envelope synchronization in coupled chaotic oscillators.

A peculiar type of synchronization has been found when two Van der PolDuffing oscillators, evolving in different chaotic attractors, are coupled. As the coupling increases, the frequencies of the two oscillators remain different, while a synchronized modulation of the amplitudes of a signal of each system develops, and a null Lyapunov exponent of the uncoupled systems becomes negative and gradually larger in absolute value. This phenomenon is characterized by an appropriate correlation function between the returns of the signals, and interpreted in terms of the mutual excitation of new frequencies in the oscillators power spectra. This form of synchronization also occurs in other systems, but it shows up mixed with or screened by other forms of synchronization, as illustrated in this paper by means of the examples of the dynamic behavior observed for three other different models of chaotic oscillators.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.