16 resultados para Near-Duplicate Detection

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A miniaturised gas analyser is described and evaluated based on the use of a substrate-integrated hollow waveguide (iHWG) coupled to a microsized near-infrared spectrophotometer comprising a linear variable filter and an array of InGaAs detectors. This gas sensing system was applied to analyse surrogate samples of natural fuel gas containing methane, ethane, propane and butane, quantified by using multivariate regression models based on partial least square (PLS) algorithms and Savitzky-Golay 1(st) derivative data preprocessing. The external validation of the obtained models reveals root mean square errors of prediction of 0.37, 0.36, 0.67 and 0.37% (v/v), for methane, ethane, propane and butane, respectively. The developed sensing system provides particularly rapid response times upon composition changes of the gaseous sample (approximately 2 s) due the minute volume of the iHWG-based measurement cell. The sensing system developed in this study is fully portable with a hand-held sized analyser footprint, and thus ideally suited for field analysis. Last but not least, the obtained results corroborate the potential of NIR-iHWG analysers for monitoring the quality of natural gas and petrochemical gaseous products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Split-plot design (SPD) and near-infrared chemical imaging were used to study the homogeneity of the drug paracetamol loaded in films and prepared from mixtures of the biocompatible polymers hydroxypropyl methylcellulose, polyvinylpyrrolidone, and polyethyleneglycol. The study was split into two parts: a partial least-squares (PLS) model was developed for a pixel-to-pixel quantification of the drug loaded into films. Afterwards, a SPD was developed to study the influence of the polymeric composition of films and the two process conditions related to their preparation (percentage of the drug in the formulations and curing temperature) on the homogeneity of the drug dispersed in the polymeric matrix. Chemical images of each formulation of the SPD were obtained by pixel-to-pixel predictions of the drug using the PLS model of the first part, and macropixel analyses were performed for each image to obtain the y-responses (homogeneity parameter). The design was modeled using PLS regression, allowing only the most relevant factors to remain in the final model. The interpretation of the SPD was enhanced by utilizing the orthogonal PLS algorithm, where the y-orthogonal variations in the design were separated from the y-correlated variation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess quality of care of women with severe maternal morbidity and to identify associated factors. This is a national multicenter cross-sectional study performing surveillance for severe maternal morbidity, using the World Health Organization criteria. The expected number of maternal deaths was calculated with the maternal severity index (MSI) based on the severity of complication, and the standardized mortality ratio (SMR) for each center was estimated. Analyses on the adequacy of care were performed. 17 hospitals were classified as providing adequate and 10 as nonadequate care. Besides almost twofold increase in maternal mortality ratio, the main factors associated with nonadequate performance were geographic difficulty in accessing health services (P < 0.001), delays related to quality of medical care (P = 0.012), absence of blood derivatives (P = 0.013), difficulties of communication between health services (P = 0.004), and any delay during the whole process (P = 0.039). This is an example of how evaluation of the performance of health services is possible, using a benchmarking tool specific to Obstetrics. In this study the MSI was a useful tool for identifying differences in maternal mortality ratios and factors associated with nonadequate performance of care.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A method using the ring-oven technique for pre-concentration in filter paper discs and near infrared hyperspectral imaging is proposed to identify four detergent and dispersant additives, and to determine their concentration in gasoline. Different approaches were used to select the best image data processing in order to gather the relevant spectral information. This was attained by selecting the pixels of the region of interest (ROI), using a pre-calculated threshold value of the PCA scores arranged as histograms, to select the spectra set; summing up the selected spectra to achieve representativeness; and compensating for the superimposed filter paper spectral information, also supported by scores histograms for each individual sample. The best classification model was achieved using linear discriminant analysis and genetic algorithm (LDA/GA), whose correct classification rate in the external validation set was 92%. Previous classification of the type of additive present in the gasoline is necessary to define the PLS model required for its quantitative determination. Considering that two of the additives studied present high spectral similarity, a PLS regression model was constructed to predict their content in gasoline, while two additional models were used for the remaining additives. The results for the external validation of these regression models showed a mean percentage error of prediction varying from 5 to 15%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity. Multicenter cross-sectional study. Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010. A total of 9555 women categorized as having obstetric complications. The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women. The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome. Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death). Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conventional reflectance spectroscopy (NIRS) and hyperspectral imaging (HI) in the near-infrared region (1000-2500 nm) are evaluated and compared, using, as the case study, the determination of relevant properties related to the quality of natural rubber. Mooney viscosity (MV) and plasticity indices (PI) (PI0 - original plasticity, PI30 - plasticity after accelerated aging, and PRI - the plasticity retention index after accelerated aging) of rubber were determined using multivariate regression models. Two hundred and eighty six samples of rubber were measured using conventional and hyperspectral near-infrared imaging reflectance instruments in the range of 1000-2500 nm. The sample set was split into regression (n = 191) and external validation (n = 95) sub-sets. Three instruments were employed for data acquisition: a line scanning hyperspectral camera and two conventional FT-NIR spectrometers. Sample heterogeneity was evaluated using hyperspectral images obtained with a resolution of 150 × 150 μm and principal component analysis. The probed sample area (5 cm(2); 24,000 pixels) to achieve representativeness was found to be equivalent to the average of 6 spectra for a 1 cm diameter probing circular window of one FT-NIR instrument. The other spectrophotometer can probe the whole sample in only one measurement. The results show that the rubber properties can be determined with very similar accuracy and precision by Partial Least Square (PLS) regression models regardless of whether HI-NIR or conventional FT-NIR produce the spectral datasets. The best Root Mean Square Errors of Prediction (RMSEPs) of external validation for MV, PI0, PI30, and PRI were 4.3, 1.8, 3.4, and 5.3%, respectively. Though the quantitative results provided by the three instruments can be considered equivalent, the hyperspectral imaging instrument presents a number of advantages, being about 6 times faster than conventional bulk spectrometers, producing robust spectral data by ensuring sample representativeness, and minimizing the effect of the presence of contaminants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess the occurrence of severe maternal complications owing to postpartum hemorrhage (PPH) and its associated factors. A secondary analysis of data from a multicenter cross-sectional prospective surveillance study included 9555 cases of severe maternal morbidity at 27 centers in Brazil between July 2009 and June 2010. Complications of PPH, conditions of severity management, and sociodemographic and obstetric characteristics were assessed. Factors independently associated with severe maternal outcome (SMO) were identified using multiple regression analysis. Overall, 1192 (12.5%) of the 9555 women experienced complications owing to PPH (981 had potentially life-threatening conditions, 181 maternal near miss, and 30 had died). The SMO ratio was 2.6 per 1000 live births among women with PPH and 8.5 per 1000 live births among women with other complications. Women with PPH had a higher risk of blood transfusion and return to the operating theater than did those with complications from other causes. Maternal age, length of pregnancy, previous uterine scar, and cesarean delivery were the main factors associated with an increased risk of SMO secondary to PPH. PPH frequently leads to severe maternal morbidity. A surveillance system can identify the main causes of morbidity and could help to improve care, especially among women identified as being at high risk of PPH.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Optical chemical sensors with detection in the near and mid infrared region are reviewed. Fundamental concepts of infrared spectroscopy and optical chemical sensors are briefly described, before presenting some aspects on optical chemical sensors, such as synthesis of NIR and IR reagents, preparation of new materials as well as application in determinations of species of biological, industrial and environmental importance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this work was to evaluate the floristic composition, richness, and diversity of the upper and lower strata of a stretch of mixed rain forest near the city of Itaberá, in southeastern Brazil. We also investigated the differences between this conservation area and other stretches of mixed rain forest in southern and southeastern Brazil, as well as other nearby forest formations, in terms of their floristic relationships. For our survey of the upper stratum (diameter at breast height [DBH] > 15 cm), we established 50 permanent plots of 10 × 20 m. Within each of those plots, we designated five, randomly located, 1 × 1 m subplots, in order to survey the lower stratum (total height > 30 cm and DBH < 15 cm). In the upper stratum, we sampled 1429 trees and shrubs, belonging to 134 species, 93 genera, and 47 families. In the lower stratum, we sampled 758 trees and shrubs, belonging to 93 species, 66 genera, and 39 families. In our floristic and phytosociological surveys, we recorded 177 species, belonging to 106 genera and 52 families. The Shannon Diversity Index was 4.12 and 3.5 for the upper and lower strata, respectively. Cluster analysis indicated that nearby forest formations had the strongest floristic influence on the study area, which was therefore distinct from other mixed rain forests in southern Brazil and in the Serra da Mantiqueira mountain range.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.