9 resultados para Host biology

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human land use tends to decrease the diversity of native plant species and facilitate the invasion and establishment of exotic ones. Such changes in land use and plant community composition usually have negative impacts on the assemblages of native herbivorous insects. Highly specialized herbivores are expected to be especially sensitive to land use intensification and the presence of exotic plant species because they are neither capable of consuming alternative plant species of the native flora nor exotic plant species. Therefore, higher levels of land use intensity might reduce the proportion of highly specialized herbivores, which ultimately would lead to changes in the specialization of interactions in plant-herbivore networks. This study investigates the community-wide effects of land use intensity on the degree of specialization of 72 plant-herbivore networks, including effects mediated by the increase in the proportion of exotic plant species. Contrary to our expectation, the net effect of land use intensity on network specialization was positive. However, this positive effect of land use intensity was partially canceled by an opposite effect of the proportion of exotic plant species on network specialization. When we analyzed networks composed exclusively of endophagous herbivores separately from those composed exclusively of exophagous herbivores, we found that only endophages showed a consistent change in network specialization at higher land use levels. Altogether, these results indicate that land use intensity is an important ecological driver of network specialization, by way of reducing the local host range of herbivore guilds with highly specialized feeding habits. However, because the effect of land use intensity is offset by an opposite effect owing to the proportion of exotic host species, the net effect of land use in a given herbivore assemblage will likely depend on the extent of the replacement of native host species with exotic ones.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This survey aimed at describing the interactions of floral visitors and Davilla kunthii A. St.-Hil. as well as characteristics of its reproductive biology in Itacoatiara, state of Amazonas, Brazil. Tests of the breeding system were performed. The guild of visitors was described according to richness, abundance, relative frequency and constancy. The breeding system tests indicated that D. kunthii is self-compatible. The pollination system was characterized as generalist, with 39 visitor species, from three different orders. Bees were the main group of pollinators, thus some behavioural aspects were described. Th e period of highest foraging activity was between 7 and 10 am. Some species presented agonistic and monopolistic behaviour. Given the behaviour and destructive potential, the Curculionidae seem to have a greater impact as seed predators than pollinators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.