12 resultados para FAILURE DETECTION
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
To evaluate vaginal microbiological and functional aspects in women with and without premature ovarian failure (POF) and the relationship with sexual function. A cross-sectional study of 36 women with POF under hormonal therapy who were age-matched with 36 women with normal gonadal function. The vaginal tropism was assessed through hormonal vaginal cytology, vaginal pH and vaginal health index (VHI). Vaginal flora were assessed by the amine test, bacterioscopy and culture for fungi. Sexual function was evaluated through the questionnaire Female Sexual Function Index (FSFI). Women in both groups were of similar age and showed similar marital status. The two groups presented vaginal tropic scores according to the VHI but the tropism was worse among women in the POF group. No difference was observed with respect to hormonal cytology and pH. Vaginal flora was similar in both groups. Women with POF showed worse sexual performance with more pain and poorer lubrication than women in the control group. The VHI, the only parameter evaluated showing statistical difference between the groups, did not correlate with the domains of pain and lubrication in the FSFI questionnaire. These findings suggest that the use of systemic estrogen among women with POF is not enough to improve complaints of lubrication and pain despite conferring similar tropism and vaginal flora. Other therapeutic options need to be evaluated.
Resumo:
36
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
Weight loss failure is a widely recognized occurrence following Roux-en-Y gastric bypass. This study aims to identify predictors associated with weight loss failure. It is a retrospective cohort which enrolled 187 subjects who underwent RYGB. Comparisons were made between patients' features at baseline and 24 months after surgery. A weight loss failure rate of 11.2% was found. Advanced age and diabetes were statistically associated with failure. The results found were close to previous reports. As weight loss failure represents an important concern, there is the possibility to perform revisional surgeries, which may emphasize the restrictive or malabsorptive characteristics of RYGB, leading to varied results. It is reinforced that weight loss cannot be used as the unique outcome to evaluate the success of surgery.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
To evaluate some microbiological aspects of the vaginal flora and the vaginal trophism of women with premature ovarian failure (POF) in use of oral hormone therapy. A cross-sectional study with 36 women with POF under the age of 40 years using oral hormonal therapy. They were age matched with 36 women with normal gonadal function (control group). The characteristics of the vaginal epithelium were assessed through the hormonal vaginal cytology, vaginal pH measurement and vaginal health index to identify vaginal disturbances. Vaginal microflora was evaluated by the amine test, bacterioscopy (Nugent score) and culture for fungi to identify vaginal abnormal microflora and fungi infections. Despite the fact that there were no statistical significant differences related to the cytological aspects and pH measurements, it was found that the vaginal health index was highly superior in the control group than in the POF group (23.4 ± 1.8 vs 20.8 ± 3.5), p < 0.0001 despite both groups had trophic scores. There were no statistical significance differences regarding to vaginal microflora types and fungi infection. Oral hormone therapy for young women with POF seems to be good enough to reestablish the epithelium cells, vaginal pH and microflora.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Women with premature ovarian failure (POF) often manifest complaints involving different aspects of sexual function (SF), regardless of using hormone therapy. SF involves a complex interaction between physical, psychological, and sociocultural aspects. There are doubts about the impact of different complaints on the global context of SF of women with POF. To evaluate the percentage of influence of each of the sexuality domains on the SF in women with POF. Cross-sectional study with 80 women with POF, matched by age to 80 women with normal gonadal function. We evaluated SF through the Female Sexual Function Index (FSFI), a comparison between the POF and control groups using the Mann-Whitney test. Component exploratory factor analysis was used to assess the proportional influence of each domain on the composition of the overall SF for women in the POF group. SF was evaluated using FSFI. Exploratory Factor Analysis for components was used to evaluate the role of each domain on the SF of women with POF. The FSFI score was significantly worse for women with POF, with a decrease in arousal, lubrication, orgasm, satisfaction, and dyspareunia. Exploratory factor analysis of SF showed that the domain with greater influence in the SF was arousal, followed by desire, together accounting for 41% of the FSFI. The domains with less influence were dyspareunia and lubrication, which together accounted for 25% of the FSFI. Women with POF have impaired SF, determined mainly by changes in arousal and desire. Aspects related to lubrication and dyspareunia complaints have lower determination coefficient in SF. These results are important in adapting the approach of sexual disorders in this group of women. Benetti-Pinto CL, Soares PM, Giraldo HPD, and Yela DA. Role of the different sexuality domains on the sexual function of women with premature ovarian failure. J Sex Med 2015;12:685-689.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.