220 resultados para T helper 1 immune response
em Scielo Sa
Resumo:
In this study, we designed an experiment to predict a potential immunodominant T-cell epitope and evaluate the protectivity of this antigen in immunised mice. The T-cell epitopes of the candidate proteins (EgGST, EgA31, Eg95, EgTrp and P14-3-3) were detected using available web-based databases. The synthesised DNA was subcloned into the pET41a+ vector and expressed in Escherichia coli as a fusion to glutathione-S-transferase protein (GST). The resulting chimeric protein was then purified by affinity chromatography. Twenty female C57BL/6 mice were immunised with the antigen emulsified in Freund's adjuvant. Mouse splenocytes were then cultured in Dulbecco's Modified Eagle's Medium in the presence of the antigen. The production of interferon-γ was significantly higher in the immunised mice than in the control mice (> 1,300 pg/mL), but interleukin (IL)-10 and IL-4 production was not statistically different between the two groups. In a challenge study in which mice were infected with 500 live protoscolices, a high protectivity level (99.6%) was demonstrated in immunised BALB/C mice compared to the findings in the control groups [GST and adjuvant (Adj) ]. These results demonstrate the successful application of the predicted T-cell epitope in designing a vaccine against Echinococcus granulosus in a mouse model.
Resumo:
Highly active antiretroviral treatment (HAART) of human immunodeficiency type 1 (HIV-1) infection is very effective in controlling infection, but elimination of viral infection has not been achieved as yet, and upon treatment interruption an immediate rebound of viremia is observed. A combination of HAART with an immune stimulation might allow treatment interruption without this rebounding viremia, as the very low viremias observed with successful HAART may be insufficient to permit maintenance of a specific anti-HIV-1 immune response. The objective of this study was to compare the humoral immune response of individuals undergoing successful HAART (NF=no failure) with that of individuals with evidence of failure of therapy (FT) and to verify if the viremia peaks observed in individuals with therapy failure would act as a specific stimulus for the humoral anti-HIV-1 immune response. Antibodies binding to gp120 V3 genotype consensus peptides were more frequently observed for FT, mainly against peptides corresponding to sequences of genotypes prevalent in the Rio de Janeiro city area, B and F. HIV-1 neutralization of HIV-1 IIIB and of four primary isolates from Rio de Janeiro was less frequently observed for plasma from the NF than the FT group, but this difference was more expressive when plasma from individuals with detectable viremia were compared to that of individuals with undetectable viral loads in the year before sample collection. Although statistically significant differences were observed only in some specific comparisons, the study indicates that presence of detectable viremia may contribute to the maintenance of a specific anti-HIV-1 humoral immune response.
Resumo:
Efforts to characterize HIV-1 polymorphism and anti-HIV immune response are being made in areas where anti-HIV/AIDS vaccines are to be employed. Anti-HIV-1 humoral immune response is being studied in infected individuals resident in Rio de Janeiro, in distinct cohorts involving recent seroconvertors, pregnant women or intravenous drug users (IDU). Comparative analyses of specificity of antibody response towards epitopes important for anti-HIV-1 immune response indicate quantitative differences between cohorts, with an exceptionally strong response in IDUs and weakest response in pregnant women. However, a comparative analysis between pregnant women cohorts from Rio de Janeiro and Rio Grande do Sul indicated an even lower response (with exception of the anti-V3-C clade peptide recognition) for the southern cohort. Studies analysing the immune function of the humoral response indicate a quite elevated occurrence of antibodies capable of neutralizing heterologous primary HIV-1 isolates from Rio de Janeiro. Attempts to correlate seroreactivity with HIV-1 neutralization with respect to HIV-1 polymorphism were not very successfull: while the Brazilian B clade B" variant could be recognized by binding assays, no significant distinction of HIV-1 clades/variants was observed in viral neutralization assays.
Resumo:
Chronic Schistosoma mansoni infection leads to a type 2-immune response with increased production of interleukin (IL-10). Evidence indicates chronic exposure to S. mansoni down regulates the type 1 immune response and prevents the onset of Th1-mediated diseases such as multiple sclerosis, diabetes mellitus and Cronh's disease. Furthermore, our own studies have revealed that chronic exposure to S. mansoni also down regulates atopic disease, Th2-mediated diseases. Our studies show an inverse association between the skin prick test reactivity and infection with S. mansoni and show the severity of asthma is reduced in subjects living in an endemic area of S. mansoni. Moreover, we hypothesize the mechanisms involved in the modulation of inflammatory response in atopic individuals, is likely dependent on IL-10 production, an anti-inflammatory cytokine elevated during helminth infections. Patients with asthma and helminth infections produced less IL-5 than patients with asthma without helminth infections, and this down regulation could, in part, be mediated by IL-10. In conclusion, helminthic infections, through induction of regulatory mechanisms, such as IL-10 production, are able to modulate the inflammatory immune response involved in the pathology of auto-immune and allergic disease.
Resumo:
The results presented in this review summarize a seirs of experiments designed to characterize the murine T cell imune response to the protozoan parasite Leishmania tropica. Enriched T cell populations and T cell clones specific for L. tropica antigens were derived from lymph nodes of primed mice and maintained in continous culture in vitro. These T lymphocytes were shown (A) to express the Lyt 1+ 3- cell surface phenotype, (B) to proliferate specifically in vitro in response to parasite antigens, together with a source of irradiated syngeneic macrophages, (C) to transfer antigen-specific delayed-type hypersensitivity (DTH) responses to normal syngeneic mice, (D) to induce specific activation of parasitized macrophages in vitro resulting in the destruction of intracellular parasites, (E) to provide specific helper activity for antibody responses in vitro in a hapten-carrier system. Protection studies using these defiened T cell populations should allow the characterization of parasite antigen(s) implicated in the induction of cellular immune responses beneficial for the host.
Resumo:
Human immunodeficiency virus (HIV-1) has become an important risk factor for human papillomavirus (HPV) infection and the development of HPV associated lesions in the female genital tract. HIV-1 may also increase the oncogenicity of high risk HPV types and the activation of low risk types. The Center for Disease Control and Prevention declared invasive cervical cancer an acquired immunodeficience virus (AIDS) defining illness in HIV positive women. Furthermore, cervical cancer happens to be the second most common female cancer worldwide. The host's local immune response plays a critical factor in controlling these conditions, as well as in changes in the number of professional antigen-presenting cells, cytokine, and MHC molecules expression. Also, the production of cytokines may determine which arm of the immune response will be stimulated and may influence the magnitude of immune protection. Although there are many studies describing the inflammatory response in HPV infection, few data are available to demonstrate the influence of the HIV infection and several questions regarding the cervical immune response are still unknown. In this review we present a brief account of the current understanding of HIV/HPV co-infection, emphasizing cervical immune response.
Resumo:
Given that highly active antiretroviral therapy (HAART) has been demonstrated useful to restore immune competence in type-1 human immunodeficiency virus (HIV-1)-infected subjects, we evaluated the specific antibody response to influenza vaccine in a cohort of HIV-1-infected children on HAART so as to analyze the quality of this immune response in patients under antiretroviral therapy. Sixteen HIV-1-infected children and 10 HIV-1 seronegative controls were immunized with a commercially available trivalent inactivated influenza vaccine containing the strains A/H1N1, A/H3N2, and B. Serum hemagglutinin inhibition (HI) antibody titers were determined for the three viral strains at the time of vaccination and 1 month later. Immunization induced a significantly increased humoral response against the three influenza virus strains in controls, and only against A/H3N2 in HIV-1-infected children. The comparison of post-vaccination HI titers between HIV-1+ patients and HIV-1 negative controls showed significantly higher HI titers against the three strains in controls. In addition, post vaccination protective HI titers (defined as equal to or higher than 1:40) against the strains A/H3N2 and B were observed in a lower proportion of HIV-1+ children than in controls, while a similar proportion of individuals from each group achieved protective HI titers against the A/H1N1 strain. The CD4+ T cell count, CD4/CD8 T cells ratio, and serum viral load were not affected by influenza virus vaccination when pre- vs post-vaccination values were compared. These findings suggest that despite the fact that HAART is efficient in controlling HIV-1 replication and in increasing CD4+ T cell count in HIV-1-infected children, restoration of immune competence and response to cognate antigens remain incomplete, indicating that additional therapeutic strategies are required to achieve a full reconstitution of immune functions.
Resumo:
Although the attenuated Mycobacterium bovis Bacillus Calmette-Guérin (BCG) vaccine has been used since 1921, tuberculosis (TB) control still proceeds at a slow pace. The main reason is the variable efficacy of BCG protection against TB among adults, which ranges from 0-80%. Subsequently, the mc2-CMX vaccine was developed with promising results. Nonetheless, this recombinant vaccine needs to be compared to the standard BCG vaccine. The objective of this study was to evaluate the immune response induced by mc2-CMX and compare it to the response generated by BCG. BALB/c mice were immunised with both vaccines and challenged withMycobacterium tuberculosis (Mtb). The immune and inflammatory responses were evaluated by ELISA, flow cytometry, and histopathology. Mice vaccinated with mc2-CMX and challenged with Mtb induced an increase in the IgG1 and IgG2 levels against CMX as well as recalled specific CD4+ T-cells that produced T-helper 1 cytokines in the lungs and spleen compared with BCG vaccinated and challenged mice. Both vaccines reduced the lung inflammatory pathology induced by the Mtb infection. The mc2-CMX vaccine induces a humoral and cellular response that is superior to BCG and is efficiently recalled after challenge with Mtb, although both vaccines induced similar inflammatory reductions.
Resumo:
Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Leptospirosis severity may be increasing, with pulmonary involvement becoming more frequent. Does this increase result from an intense immune response to leptospire? Notice that renal failure, thrombocytopenia and pulmonary complications are found during the immune phase. Thirty-five hospitalized patients with Weil's disease had 5 blood samples drawn, from the 15th day to the 12th month of symptoms, for ELISA-IgM, -IgG and -IgA specific antibody detection. According their 1st IgG titer, the patients were divided into: group 1 (n = 13) titer > 1:400 (positive) and group 2 (n = 22) titer <=1:400 (negative). Early IgG antibodies in group 1 showed high avidity which may indicate reinfection. Group 1 was older, had worse pulmonary and renal function, and fever for a longer period than group 2. Throughout the study, IgG and IgA titers remained higher in group 1. In conclusion, the severity of Weil's disease may be associated with the intensity of the humoral immune response to leptospire.
Resumo:
Dipetalogaster maximus embryo extracts were used to stimulate peripheral blood mononuclear cells (PBMC) and in ELISA with sera either from Trypanosoma cruzi infected or non-infected individuals. The results showed that there was significant proliferative response and high antibody titers in sera of chagasic patients.
Resumo:
Philander frenata and Didelphis marsupialis harbor parasitism by Trypanosoma cruzi without developing any apparent disease and on the contrary to D. marsupialis, P. frenata maintains parasitism by T. cruzi II subpopulations. Here we compared the humoral immune response of the two didelphids naturally and experimentally infected with T. cruzi II group, employing SDS-PAGE/Western blot techniques and by an Indirect immunofluorescence assay. We also studied the histopathological pattern of naturally and experimentally infected P. frenata with T. cruzi. P. frenata sera recognized more antigens than D. marsupialis, and the recognition pattern did not show any change over the course of the follow up of both didelphid species. Polypeptides of 66 and 90kDa were the most prominent antigens recognized by both species in the soluble and enriched membrane fractions. P. frenata recognized intensely also a 45kDa antigen. Our findings indicate that: 1) there were no quantitative or qualitative differences in the patent or subpatent phases in the recognition pattern of P. frenata; 2) the significant differences in the recognition pattern of parasitic antigens by P. frenata and D. marsupialis sera suggest that they probably "learned" to live in harmony with T. cruzi by different strategies; 3) although P. frenata do not display apparent disease, tissular lesions tended to be more severe than has been described in D. marsupialis; and 4) Both didelphids probably acquired infection by T. cruzi after their evolutionary divergence.