Cloning and molecular characterization of Trypanosoma cruzi U2, U4, U5, and U6 small nuclear RNAs

Small nuclear RNAs (snRNAs) are important factors in the functioning of eukaryotic cells that form several small complexes with proteins; these ribonucleoprotein particles (U snRNPs) have an essential role in the pre-mRNA processing, particularly in splicing, catalyzed by spliceosomes, large RNA-protein complexes composed of various snRNPs. Even though they are well defined in mammals, snRNPs are still not totally characterized in certain trypanosomatids as Trypanosoma cruzi. For this reason we subjected snRNAs (U2, U4, U5, and U6) from T. cruzi epimastigotes to molecular characterization by polymerase chain reaction (PCR) and reverse transcription-PCR. These amplified sequences were cloned, sequenced, and compared with those other of trypanosomatids. Among these snRNAs, U5 was less conserved and U6 the most conserved. Their respective secondary structures were predicted and compared with known T. brucei structures. In addition, the copy number of each snRNA in the T. cruzi genome was characterized by Southern blotting.

New insights into trypanosomatid U5 small nuclear ribonucleoproteins

Several protozoan parasites exist in the Trypanosomatidae family, including various agents of human diseases. Multiple lines of evidence suggest that important differences are present between the translational and mRNA processing (trans splicing) systems of trypanosomatids and other eukaryotes. In this context, certain small complexes of RNA and protein, which are named small nuclear ribonucleoproteins (U snRNPs), have an essential role in pre-mRNA processing, mainly during splicing. Even though they are well defined in mammals, snRNPs are still not well characterized in trypanosomatids. This study shows that a U5-15K protein is highly conserved among various trypanosomatid species. Tandem affinity pull-down assays revealed that this protein interacts with a novel U5-102K protein, which suggests the presence of a sub-complex that is potentially involved in the assembly of U4/U6-U5 tri-snRNPs. Functional analyses showed that U5-15K is essential for cell viability and is somehow involved with the trans and cis splicing machinery. Similar tandem affinity experiments with a trypanonosomatid U5-Cwc21 protein led to the purification of four U5 snRNP specific proteins and a Sm core, suggesting U5-Cwc-21 participation in the 35S U5 snRNP particle. Of these proteins, U5-200K was molecularly characterized. U5-200K has conserved domains, such as the DEAD/DEAH box helicase and Sec63 domains and displays a strong interaction with U5 snRNA.

Presence of autoantibodies against HeLa small nuclear ribonucleoproteins in chagasic and non-chagasic cardiac patients

We detected anti-human small nuclear ribonucleoprotein (snRNP) autoantibodies in chagasic patients by different immunological methods using HeLa snRNPs. ELISA with Trypanosoma cruzi total lysate antigen or HeLa human U small nuclear ribonucleoproteins (UsnRNPs) followed by incubation with sera from chronic chagasic and non-chagasic cardiac patients was used to screen and compare serum reactivity. Western blot analysis using a T. cruzi total cell extract was also performed in order to select some sera for Western blot and immunoprecipitation assays with HeLa nuclear extract. ELISA showed that 73 and 95% of chronic chagasic sera reacted with HeLa UsnRNPs and T. cruzi antigens, respectively. The Western blot assay demonstrated that non-chagasic cardiac sera reacted with high molecular weight proteins present in T. cruzi total extract, probably explaining the 31% reactivity found by ELISA. However, these sera reacted weakly with HeLa UsnRNPs, in contrast to the chagasic sera, which showed autoantibodies with human Sm (from Stefanie Smith, the first patient in whom this activity was identified) proteins (B/B', D1, D2, D3, E, F, and G UsnRNP). Immunoprecipitation reactions using HeLa nuclear extracts confirmed the reactivity of chagasic sera and human UsnRNA/RNPs, while the other sera reacted weakly only with U1snRNP. These findings agree with previously reported data, thus supporting the idea of the presence of autoimmune antibodies in chagasic patients. Interestingly, non-chagasic cardiac sera also showed reactivity with T. cruzi antigen and HeLa UsnRNPs, which suggests that individuals with heart disease of unknown etiology may develop autoimmune antibodies at any time. The detection of UsnRNP autoantibodies in chagasic patients might contribute to our understanding of how they develop upon initial T. cruzi infection.

Detection of Trypanosoma cruzi and Trypanosoma rangeli infection in triatomine vectors by amplification of the histone H2A/SIRE and the sno-RNA-C11 genes

Trypanosoma rangeli is non pathogenic for humans but of important medical and epidemiological interest because it shares vertebrate hosts, insect vectors, reservoirs and geographic areas with T. cruzi, the etiological agent of Chagas disease. Therefore, in this work, we set up two PCR reactions, TcH2AF/R and TrFR2, to distinguish T. cruzi from T. rangeli in mixed infections of vectors based on amplification of the histone H2A/SIRE and the small nucleolar RNA Cl1 genes, respectively. Both PCRs were able to appropriately detect all T. cruzi or T. rangeli experimentally infected-triatomines, as well as the S35/S36 PCR which amplifies the variable region of minicircle kDNA of T. cruzi. In mixed infections, whereas T. cruzi DNA was amplified in 100% of samples with TcH2AF/R and S35/S36 PCRs, T. rangeli was detected in 71% with TrF/R2 and in 6% with S35/S36. In a group of Rhodnius colombiensis collected from Coyaima (Colombia), T. cruzi was identified in 100% with both PCRs and T. rangeli in 14% with TrF/R2 and 10% with S35/S36 PCR. These results show that TcH2AF/R and TrF/R2 PCRs which are capable of recognizing all T. cruzi and T. rangeli strains and lineages could be useful for diagnosis as well as for epidemiological field studies of T. cruzi and T. rangeli vector infections.

Colocalization of coilin and nucleolar proteins in Cajal body-like structures of micronucleated PtK2 cells

Cajal bodies (CB) are ubiquitous nuclear structures involved in the biogenesis of small nuclear ribonucleoproteins and show narrow association with the nucleolus. To identify possible relationships between CB and the nucleolus, the localization of coilin, a marker of CB, and of a set of nucleolar proteins was investigated in cultured PtK2 cells undergoing micronucleation. Nocodazol-induced micronucleated cells were examined by double indirect immunofluorescence with antibodies against coilin, fibrillarin, NOR-90/hUBF, RNA polymerase I, PM/Scl, and To/Th. Cells were imaged on a BioRad 1024-UV confocal system attached to a Zeiss Axiovert 100 microscope. Since PtK2 cells possess only one nucleolus organizer region, micronucleated cells presented only one or two micronuclei containing nucleolus. By confocal microscopy we showed that in most micronuclei lacking a typical nucleolus a variable number of round structures were stained by antibodies against fibrillarin, NOR-90/hUBF protein, and coilin. These bodies were regarded as CB-like structures and were not stained by anti-PM/Scl and anti-To/Th antibodies. Anti-RNA polymerase I antibodies also reacted with CB-like structures in some micronuclei lacking nucleolus. The demonstration that a set of proteins involved in RNA/RNP biogenesis, namely coilin, fibrillarin, NOR-90/hUBF, and RNA polymerase I gather in CB-like structures present in nucleoli-devoid micronuclei may contribute to shed some light into the understanding of CB function.

In vitro modulation of Bcl-2 levels in small cell lung cancer cells: effects on cell viability

Small cell lung cancer (SCLC) is an aggressive disease, representing 15% of all cases of lung cancer, has high metastatic potential and low prognosis that urgently demands the development of novel therapeutic approaches. One of the proposed approaches has been the down-regulation of BCL2, with poorly clarified and controversial therapeutic value regarding SCLC. The use of anti-BCL2 small interfering RNA (siRNA) in SCLC has never been reported. The aim of the present study was to select and test the in vitro efficacy of anti-BCL2 siRNA sequences against the protein and mRNA levels of SCLC cells, and their effects on cytotoxicity and chemosensitization. Two anti-BCL2 siRNAs and the anti-BCL2 G3139 oligodeoxynucleotide (ODN) were evaluated in SCLC cells by the simultaneous determination of Bcl-2 and viability using a flow cytometry method recently developed by us in addition to Western blot, real-time reverse-transcription PCR, and cell growth after single and combined treatment with cisplatin. In contrast to previous reports about the use of ODN, a heterogeneous and up to 80% sequence-specific Bcl-2 protein knockdown was observed in the SW2, H2171 and H69 SCLC cell lines, although without significant sequence-specific reduction of cell viability, cell growth, or sensitization to cisplatin. Our results question previous data generated with antisense ODN and supporting the present concept of the therapeutic interest in BCL2 silencing per se in SCLC, and support the growing notion of the necessity of a multitargeting molecular approach for the treatment of cancer.

REGγ is a strong candidate for the regulation of cell cycle, proliferation and the invasion by poorly differentiated thyroid carcinoma cells

REGγ is a proteasome activator that facilitates the degradation of small peptides. Abnormally high expression of REGγ has been observed in thyroid carcinomas. The purpose of the present study was to explore the role of REGγ in poorly differentiated thyroid carcinoma (PDTC). For this purpose, small interfering RNA (siRNA) was introduced to down-regulate the level of REGγ in the PDTC cell line SW579. Down-regulation of REGγ at the mRNA and protein levels was confirmed by RT-PCR and Western blot analyses. FACS analysis revealed cell cycle arrest at the G1/S transition, the MTT assay showed inhibition of cell proliferation, and the Transwell assay showed restricted cell invasion. Furthermore, the expression of the p21 protein was increased, the expression of proliferating cell nuclear antigen (PCNA) protein decreased, and the expression of the p27 protein was unchanged as shown by Western blot analyses. REGγ plays a critical role in the cell cycle, proliferation and invasion of SW579 cells. The alteration of p21 and PCNA proteins related to the down-regulation of REGγ suggests that p21 and PCNA participate in the process of REGγ regulation of cell cycle progression and cell proliferation. Thus, targeting REGγ has a therapeutic potential in the management of PDTC patients.

Adenovirus-mediated siRNA targeting TNF-α and overexpression of bone morphogenetic protein-2 promotes early osteoblast differentiation on a cell model of Ti particle-induced inflammatory response in vitro

Wear particles are phagocytosed by macrophages and other inflammatory cells, resulting in cellular activation and release of proinflammatory factors, which cause periprosthetic osteolysis and subsequent aseptic loosening, the most common causes of total joint arthroplasty failure. During this pathological process, tumor necrosis factor-alpha (TNF-α) plays an important role in wear-particle-induced osteolysis. In this study, recombination adenovirus (Ad) vectors carrying both target genes [TNF-α small interfering RNA (TNF-α-siRNA) and bone morphogenetic protein 2 (BMP-2)] were synthesized and transfected into RAW264.7 macrophages and pro-osteoblastic MC3T3-E1 cells, respectively. The target gene BMP-2, expressed on pro-osteoblastic MC3T3-E1 cells and silenced by the TNF-α gene on cells, was treated with titanium (Ti) particles that were assessed by real-time PCR and Western blot. We showed that recombinant adenovirus (Ad-siTNFα-BMP-2) can induce osteoblast differentiation when treated with conditioned medium (CM) containing RAW264.7 macrophages challenged with a combination of Ti particles and Ad-siTNFα-BMP-2 (Ti-ad CM) assessed by alkaline phosphatase activity. The receptor activator of nuclear factor-κB ligand was downregulated in pro-osteoblastic MC3T3-E1 cells treated with Ti-ad CM in comparison with conditioned medium of RAW264.7 macrophages challenged with Ti particles (Ti CM). We suggest that Ad-siTNFα-BMP-2 induced osteoblast differentiation and inhibited osteoclastogenesis on a cell model of a Ti particle-induced inflammatory response, which may provide a novel approach for the treatment of periprosthetic osteolysis.

Targeting PPM1D by lentivirus-mediated RNA interference inhibits the tumorigenicity of bladder cancer cells

Protein phosphatase magnesium/manganese-dependent 1D (PPM1D) is a p53-induced phosphatase that functions as a negative regulator of stress response pathways and has oncogenic properties. However, the functional role ofPPM1D in bladder cancer (BC) remains largely unknown. In the present study, lentivirus vectors carrying small hairpin RNA (shRNA) targeting PPM1D were used to explore the effects ofPPM1D knockdown on BC cell proliferation and tumorigenesis. shRNA-mediated knockdown of PPM1D significantly inhibited cell growth and colony forming ability in the BC cell lines 5637 and T24. Flow cytometric analysis showed that PPM1D silencing increased the proportion of cells in the G0/G1 phase. Downregulation of PPM1Dalso inhibited 5637 cell tumorigenicity in nude mice. The results of the present study suggest that PPM1D plays a potentially important role in BC tumorigenicity, and lentivirus-mediated delivery of shRNA againstPPM1D might be a promising therapeutic strategy for the treatment of BC.

CCN2/CTGF silencing blocks cell aggregation in embryonal carcinoma P19 cell

Connective tissue growth factor (CCN2/CTGF) is a matricellular-secreted protein involved in extracellular matrix remodeling. The P19 cell line is an embryonic carcinoma line widely used as a cellular model for differentiation and migration studies. In the present study, we employed an exogenous source of CCN2 and small interference RNA to address the role of CCN2 in the P19 cell aggregation phenomenon. Our data showed that increasing CCN2 protein concentrations from 0.1 to 20 nM decreased the number of cell clusters and dramatically increased cluster size without changing proliferation or cell survival, suggesting that CCN2 induced aggregation. In addition, CCN2 specific silencing inhibited typical P19 cell aggregation, which could be partially rescued by 20 nM CCN2. The present study demonstrates that CCN2 is a key molecule for cell aggregation of embryonic P19 cells.

Inhibition of cytohesin-1 by siRNA leads to reduced IGFR signaling in prostate cancer

To explore how cytohesin-1 (CYTH-1) small interfering RNA (siRNA) influences the insulin-like growth factor receptor (IGFR)-associated signal transduction in prostate cancer, we transfected human prostate cancer PC-3 cell lines with liposome-encapsulatedCYTH-1 siRNA in serum-free medium and exposed the cells to 100 nM IGF-1. The mRNA and protein levels of the signal molecules involved in the IGFR signaling pathways were determined by real-time PCR and detected by Western blotting. The relative mRNA levels of CYTH-1, c-Myc, cyclinD1 and IGF-1R (CYTH-1 siRNA group vs scrambled siRNA group) were 0.26 vs 0.97, 0.34 vs 1.06, 0.10 vs 0.95, and 0.27 vs 0.41 (P < 0.05 for all), respectively. The relative protein levels of CYTH-1, pIGF-1R, pIRS1, pAkt1, pErk1, c-Myc, and cyclinD1 (CYTH-1 siRNA group vsscrambled siRNA group) were 0.10 vs 1.00 (30 min), 0.10 vs 0.98 (30 min), 0.04 vs 0.50 (30 min), 0.10 vs 1.00 (30 min), 0.10 vs 1.00 (30 min), 0.13 vs 0.85 (5 h), and 0.08 vs 0.80 (7 h), respectively. The tyrosine kinase activity of IGF-1R was associated with CYTH-1. The proliferative activity of PC-3 cells transfected with CYTH-1 siRNA was significantly lower than that of cells transfected with scrambled siRNA at 48 h (40.5 vs87.6%, P < 0.05) and at 72 h (34.5 vs 93.5%, P < 0.05). In conclusion, the interference of siRNA with cytohesin-1 leads to reduced IGFR signaling in prostate cancer; therefore, CYTH-1 might serve as a new molecular target for the treatment of prostate cancer.

Downregulation of survivin by siRNA inhibits invasion and promotes apoptosis in neuroblastoma SH-SY5Y cells

Neuroblastoma is a solid tumor that occurs mainly in children. Malignant neuroblastomas have a poor prognosis because conventional chemotherapeutic agents are not very effective. Survivin, a member of the inhibitor of the apoptosis protein family, plays a significant role in cell division, inhibition of apoptosis, and promotion of cell proliferation and invasion. Previous studies found that survivin is highly expressed in some malignant neuroblastomas and is correlated with poor prognosis. The aim of this study was to investigate whether survivin could serve as a potential therapeutic target of human neuroblastoma. We employed RNA interference to reduce survivin expression in the human neuroblastoma SH-SY5Y cell line and analyzed the effect of RNA interference on cell proliferation and invasion in vitro and in vivo. RNA interference of survivin led to a significant decrease in invasiveness and proliferation and increased apoptosis in SH-SY5Y cells in vitro. RNA interference of survivin inhibited tumor growth in vivo by 68±13% (P=0.002) and increased the number of apoptotic cells by 9.8±1.2% (P=0.001) compared with negative small interfering RNA (siRNA) treatment controls. Moreover, RNA interference of survivin inhibited the formation of lung metastases by 92% (P=0.002) and reduced microvascular density by 60% (P=0.0003). Survivin siRNA resulted in significant downregulation of survivin mRNA and protein expression both in vitro and in vivo compared with negative siRNA treatment controls. RNA interference of survivin was found to be a potent inhibitor of SH-SY5Y tumor growth and metastasis formation. These results support further clinical development of RNA interference of survivin as a treatment of neuroblastoma and other cancer types.

A combination of STI571 and BCR-ABL1 siRNA with overexpressed p15INK4B induced enhanced proliferation inhibition and apoptosis in chronic myeloid leukemia

p15INK4B, a cyclin-dependent kinase inhibitor, has been recognized as a tumor suppressor. Loss of or methylation of the p15INK4B gene in chronic myeloid leukemia (CML) cells enhances myeloid progenitor formation from common myeloid progenitors. Therefore, we examined the effects of overexpressed p15INK4B on proliferation and apoptosis of CML cells. Overexpression of p15INK4B inhibited the growth of K562 cells by downregulation of cyclin-dependent kinase 4 (CDK4) and cyclin D1 expression. Overexpression of p15INK4B also induced apoptosis of K562 cells by upregulating Bax expression and downregulating Bcl-2 expression. Overexpression of p15INK4B together with STI571 (imatinib) or BCR-ABL1 small interfering RNA (siRNA) also enhanced growth inhibition and apoptosis induction of K562 cells. The enhanced effect was also mediated by reduction of cyclin D1 and CDK4 and regulation of Bax and Bcl-2. In conclusion, our study may provide new insights into the role of p15INK4B in CML and a potential therapeutic target for overcoming tyrosine kinase inhibitor resistance in CML.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Footprints of a trypanosomatid RNA world: pre-small subunit rRNA processing by spliced leader addition trans-splicing

The addition of a capped mini-exon [spliced leader (SL)] through trans-splicing is essential for the maturation of RNA polymerase (pol) II-transcribed polycistronic pre-mRNAs in all members of the Trypanosomatidae family. This process is an inter-molecular splicing reaction that follows the same basic rules of cis-splicing reactions. In this study, we demonstrated that mini-exons were added to precursor ribosomal RNA (pre-rRNA) are transcribed by RNA pol I, including the 5' external transcribed spacer (ETS) region. Additionally, we detected the SL-5'ETS molecule using three distinct methods and located the acceptor site between two known 5'ETS rRNA processing sites (A' and A1) in four different trypanosomatids. Moreover, we detected a polyadenylated 5'ETS upstream of the trans-splicing acceptor site, which also occurs in pre-mRNA trans-splicing. After treatment with an indirect trans-splicing inhibitor (sinefungin), we observed SL-5'ETS decay. However, treatment with 5-fluorouracil (a precursor of RNA synthesis that inhibits the degradation of pre-rRNA) led to the accumulation of SL-5'ETS, suggesting that the molecule may play a role in rRNA degradation. The detection of trans-splicing in these molecules may indicate broad RNA-joining properties, regardless of the polymerase used for transcription.