16 resultados para road barrier damages
em Scielo Saúde Pública - SP
Resumo:
An unusually high incidence of microcephaly in newborns has recently been observed in Brazil. There is a temporal association between the increase in cases of microcephaly and the Zika virus (ZIKV) epidemic. Viral RNA has been detected in amniotic fluid samples, placental tissues and newborn and fetal brain tissues. However, much remains to be determined concerning the association between ZIKV infection and fetal malformations. In this study, we provide evidence of the transplacental transmission of ZIKV through the detection of viral proteins and viral RNA in placental tissue samples from expectant mothers infected at different stages of gestation. We observed chronic placentitis (TORCH type) with viral protein detection by immunohistochemistry in Hofbauer cells and some histiocytes in the intervillous spaces. We also demonstrated the neurotropism of the virus via the detection of viral proteins in glial cells and in some endothelial cells and the observation of scattered foci of microcalcifications in the brain tissues. Lesions were mainly located in the white matter. ZIKV RNA was also detected in these tissues by real-time-polymerase chain reaction. We believe that these findings will contribute to the body of knowledge of the mechanisms of ZIKV transmission, interactions between the virus and host cells and viral tropism.
Resumo:
Introduction The incidence of American cutaneous leishmaniasis (ACL) is increasing in Latin America, especially in Brazil, where 256,587 cases were confirmed in the last decade. Methods This study used a Bayesian model to examine the spatial and temporal distribution of ACL cases between 2000 and 2009 in 61 counties of State of Maranhão located along the three main road and railway corridors. Results During the study period, 13,818 cases of ACL were recorded. There was a significant decrease in the incidence of ACL in the ten study years. The recorded incidence rate ranged from 7.36 to 241.45 per 100,000 inhabitants. The relative risk increased in 77% of the counties, decreased in 18% and was maintained in only five counties. Conclusions Although there was a decreased incidence of the disease, ACL was present in all of the examined municipalities, thus maintaining the risk of contracting this illness.
Resumo:
Occurrence and damages of Danothrips trifasciatus (Thysanoptera: Thripidae) on Calophyllum brasiliense (Clusiaceae) in Brazil. Danothrips trifasciatus Sakimura, 1975 (Thysanoptera, Thripidae) is recorded for the first time in Brazil, in the municipality of Garça, São Paulo state. Individuals were collected in April 2011 damaging young leaves of guanandi, Calophyllum brasiliense Cambess. (Clusiaceae), forest species of increasing importance in Brazil. Future studies involving aspects on biology and population dynamics of the thrips in this plant species need to be carried out, in order to establish its potential economic importance to guanandi.
Resumo:
Acid mine drainage (AMD) is an environmental concern due to the risk of element mobilization, including toxic elements, and inclusion in the food chain. In this study, three cover layers were tested to minimize As, Fe and S mobilization from a substrate from former gold mining, containing pyrite and arsenopyrite. For this purpose, different layers (capillary break, sealant and cover layer) above the substrate and the induction of a geochemical barrier (GB) were used to provide suitable conditions for adsorption and co-precipitation of the mobilized As. Thirteen treatments were established to evaluate the leaching of As, Fe and S from a substrate in lysimeters. The pH, As, Fe, S, Na, and K concentrations and total volume of the leachates were determined. Mineralogical analyses were realized in the substrate at the end of the experimental period. Lowest amounts of As, Fe and S (average values of 5.47, 48.59 and 132.89 g/lysimeter) were leached in the treatments that received Na and K to induce GB formation. Mineralogical analyses indicated jarosite formation in the control treatment and in treatments that received Na and K salts. However, the jarosite amounts in these treatments were higher than in the control, suggesting that these salts accelerated the GB formation. High amounts of As, Fe and S (average values of 11.7, 103.94 and 201.13 g/lysimeter) were observed in the leachate from treatments without capillary break layer. The formation of geochemical barrier and the use of different layers over the sulfide substrate proved to be efficient techniques to decrease As, Fe and S mobilization and mitigate the impact of acid mine drainage.
Resumo:
Este trabalho foi realizado com o objetivo de estabelecer a melhor concentração de sais do meio MS e da citocinina BAP para a multiplicação dos porta-enxertos de Prunus sp. 'Barrier' e 'Cadaman'. Segmentos nodais foram introduzidos em tubos de ensaio contendo 10 mL de meio de cultura com variações na concentração de sais (MS; ½MS; e 2/3MS) combinadas com cinco concentrações de BAP (0; 1,5; 2,5; 3,5 e 4,5 miM). Utilizou-se um fatorial 2x3x5, distribuído em blocos casualizados, compostos por quatro repetições contendo cinco tubos de ensaio cada uma, sendo inoculado um segmento nodal por tubo. As avaliações foram realizadas após cinco semanas de cultivo em ambiente com intensidade luminosa de 20 miE m-2 s-1, fotoperíodo de 16 horas e temperatura de 24 ± 4ºC. Verificou-se maior número médio de gemas e de brotações para a cultivar Barrier. À medida que se reduziu a concentração de sais do meio de cultura, obteve-se maior número de brotações, porém com menor tamanho. As regressões polinomiais das variáveis número de gemas, brotações por explante e comprimento das brotações apresentaram um ajustamento quadrático para níveis de BAP, atingindo os pontos de máximo 31,2 gemas/explante; 4,6 brotações por explante, e 8,1 mm de comprimento nas concentrações 3,3; 3,1, e 3,1 miM de BAP, respectivamente.
Resumo:
A simple ion pair-dispersive liquid-liquid microextraction method was proposed for preconcentration trace amounts of rhodium. An ion association complex of RhCl4- and tetradecyldimetylbenzylamonium was extracted into cholorobenzene. The volume and the type of extractive and dispersive solvents, the extraction time and the pH of the aqueous solutions were optimized. The calibration curve was linear in the range of 0.6-500 ng mL-1 of rhodium. The limit of detection was 0.10 ng mL-1 in initial solution and preconcentration factor was 40. The proposed method was successfully applied to the extraction and determination of rhodium in road dust and water samples.
Resumo:
In this study, a procedure is developed for cloud point extraction of Pd(II) and Rh(III) ions in aqueous solution using Span 80 (non-ionic surfactant) prior to their determination by flame atomic absorption spectroscopy. This method is based on the extraction of Pd(II) and Rh(III) ions at a pH of 10 using Span 80 with no chelating agent. We investigated the effect of various parameters on the recovery of the analyte ions, including pH, equilibration temperature and time, concentration of Span 80, and ionic strength. Under the best experimental conditions, the limits of detection based on 3Sb for Pd(II) and Rh(III) ions were 1.3 and 1.2 ng mL-1, respectively. Seven replicate determinations of a mixture of 0.5 µg mL-1 palladium and rhodium ions gave a mean absorbance of 0.058 and 0.053 with relative standard deviations of 1.8 and 1.6%, respectively. The developed method was successfully applied to the extraction and determination of the palladium and rhodium ions in road dust and standard samples and satisfactory results were obtained.
Resumo:
The objective of the present study was to evaluate the effects of industrial solid waste (whitewash mud) on geotechnical properties considering the following engineering parameters: California Bearing Ratio (CBR), Atterberg limits and Permeability test. Seven soil samples derived from Alagoinhas, Bahia - Brazil, were classified by the Transportation Research Board (TRB) system. Two were selected as having a great geotecnical potential classified as A-3 (0) and A-2-4 (0), whitewash mud contents 10%, 15%, 20% and 25% dry weight and medium compaction effort were studied in the laboratory testing program. The results indicated the soil denominated good gravel as being the most promising one, when stabilized with whitewash mud, reaching the best results with the dosage of 20 and 25% of whitewash mud.
Resumo:
Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.