Padrões distributivos e zoogeografia dos moluscos da plataforma continental brasileira: Parte III. Comissão Oceanográfica Espiríto Santo I

One hundred senventy-five species of marine mollusks have been identified in the Expedition Espírito Santo I. Standing out the species Margarites olivaceus (Brown, 1827); Cyclostremiscus caraboboensis Weishord, 1962; Balcis gibba Folin, 1867; Triphora compsa (Dall, 1927); Henrya af. goldmani Bartsh, 1947 and Limaea subovata Jeffreys, 1876 as they have not been previously assigned to Brazil. The analysis of the geographical distribution patterns points out the dominance of the species with thermophiles affinities. This situation evidences the importance of the Brazilian Current in the maintanance of the biogeographical structure of the studied region. However, it is the analysis of the cryophiles species that shows the Cabo Frio region as an ecological filter quite more permeable to the species with thermophile affinities than to the cryophiles ones. The existence of this barrier and the endemism rate (4.27%) characterize the region that extends from the south of Cabo Frio as a transition between the two patterns cited above. Therefore they do not corroborate in malacological parameters the proposition made by Palacio (1982) for the individualization of the Paulista Province.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Heterotaxy syndrome: a case report

The present report describes the findings at chest computed tomography angiography of a 28-year-old female patient with heterotaxy syndrome. This syndrome consists of a variety of anomalies of position and morphology of thoracoabdominal organs which do not follow the situs solitus or situs inversus arrangement. Imaging studies play a fundamental role in the individualization of the approach to the patient.

Proximal tubular dysfunction as an indicator of chronic graft dysfunction

New strategies are being devised to limit the impact of renal sclerosis on graft function. Individualization of immunosuppression, specifically the interruption of calcineurin-inhibitors has been tried in order to promote better graft survival once chronic graft dysfunction has been established. However, the long-term impact of these approaches is still not totally clear. Nevertheless, patients at higher risk for tubular atrophy and interstitial fibrosis (TA/IF) development should be carefully monitored for tubular function as well as glomerular performance. Since tubular-interstitial impairment is an early event in TA/IF pathogenesis and associated with graft function, it seems reasonable that strategies directed at assessing tubular structural integrity and function would yield important functional and prognostic data. The measurement of small proteins in urine such as α-1-microglobulin, N-acetyl-beta-D-glucosaminidase, alpha/pi S-glutathione transferases, β-2 microglobulin, and retinol binding protein is associated with proximal tubular cell dysfunction. Therefore, its straightforward assessment could provide a powerful tool in patient monitoring and ongoing clinical assessment of graft function, ultimately helping to facilitate longer patient and graft survival associated with good graft function.