Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

Pentamidine (PEN) is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK) into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

A new repetitive DNA sequence from Trypanosoma cruzi

Tandemly repeated DNA sequences are found in the genome of higher eukaryotes, and have also been demonstrated in Trypanosoma cruzi. Repeated DNA sequences are potentially useful for the diagnostic detection of T. cruzi (A. Gonzales et al., 1984, Proc. Natl. Acad. Sci. USA, 81: 3356-3360). We have isoleted two clones from a genomic library of T. cruzi (Y strain) that contain, in one clone a family of at least seven copies of a repetitive sequence of approximately 600 base pairs, and in the other an independent copy of the same sequence. One copy of the repetition (HSP) and the independent clone (HCR) were sequenced by the Sanger procedure (Fig.). This sequence hybridized to four strains of T. cruzi tested and did not hybridize to eleven species of trypanosotids from five different Genera, being a good candidate for diagnostic assays. GenBank accession numbers: HSP#m31919, HCR#31920.

Isolation of a distally located gene possibly correlated with gametocyte production ability

Previous studies were focussed on the attempt to correlate observable variations in the size of Plasmodium berghei chromosomes with the loss of ability to produce viable gametocytes. A temporal coincidence between the appearance of a subtelomeric deletion on P. berghei chromosome 5 and the loss of the ability to produce viable gametocytes was observed in a clone (HPE) directly derived from the high gametocyte-producer clone 8417 during mechanical passages. Interestingly enough, three P. berghei sexual-specific genes have already been mapped on internal fragments of this chromosome. A novel gene, clone 150, isolated from a genomic library of clone 8417 using a probe enriched for sexual-specific transcripts, maps on chromosome 5 within 100kb from the telomere. Subtelomeric deletions of chromosome 5 affecting two non-producer clones involve part of the transcribed region of this gene.

Variation between geographical populations of Lutzomyia (Nyssomyia) whitmani (Antunes & Coutinho, 1939) sensu lato (Diptera:Psychodidae:Phlebotominae) in Brazil

Phylogenetic analysis of morphometric and biological characters indicated that there are two distinct forms of Lutzomyia whitmani in Brazil: one is present both north and south of the River Amazonas in the State of Pará while the other occurs in northeast Brazil, in the State of Ceará, and further south, including the type locality in State of Bahia. The Amazonian form is reportedly neither strongly anthropophilic nor synanthropic, and it is the vector of Leishmania shawi; whereas the southern form is often collected peridomestically, while biting man, and has been found infected with Le.(V.) braziliensis. The ratio of the length of the genital filaments to that the genital pump was found to be consistently smaller in males of the Amazonian populations. A middle repetitive DNA element was isolated by differentially screening a genomic library made using Amazonian material, and the sequence was diagnostic for this form of Lu. whitmani (being absent or occurring in low copy number in the southern form). The total evidence suggests there are at least two, geographically-isolated forms of Lu. whitmani, which may represent different cryptic species.

Towards the Physical Map of the Trypanosoma cruzi Nuclear Genome: Construction of YAC and BAC Libraries of the Reference Clone T. cruzi CL-Brener

Strategies to construct the physical map of the Trypanosoma cruzi nuclear genome have to capitalize on three main advantages of the parasite genome, namely (a) its small size, (b) the fact that all chromosomes can be defined, and many of them can be isolated by pulse field gel electrophoresis, and (c) the fact that simple Southern blots of electrophoretic karyotypes can be used to map sequence tagged sites and expressed sequence tags to chromosomal bands. A major drawback to cope with is the complexity of T. cruzi genetics, that hinders the construction of a comprehensive genetic map. As a first step towards physical mapping, we report the construction and partial characterization of a T. cruzi CL-Brener genomic library in yeast artificial chromosomes (YACs) that consists of 2,770 individual YACs with a mean insert size of 365 kb encompassing around 10 genomic equivalents. Two libraries in bacterial artificial chromosomes (BACs) have been constructed, BACI and BACII. Both libraries represent about three genome equivalents. A third BAC library (BAC III) is being constructed. YACs and BACs are invaluable tools for physical mapping. More generally, they have to be considered as a common resource for research in Chagas disease

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Study of a region on yeast chromosome XIII that complements pet G199 mutants (COX7) and carries a new non-essential gene

The mutants of Saccharomyces cerevisiae assigned to complementation group G199 are deficient in mitochondrial respiration and lack a functional cytochrome oxidase complex. Recombinant plasmids capable of restoring respiration were cloned by transformation of mutants of this group with a yeast genomic library. Sequencing indicated that a 2.1-kb subclone encompasses the very end (last 11 amino acids) of the PET111 gene, the COX7 gene and a new gene (YMR255W) of unknown function that potentially codes for a polypeptide of 188 amino acids (about 21.5 kDa) without significant homology to any known protein. We have shown that the respiratory defect corresponding to group G199 is complemented by plasmids carrying only the COX7 gene. The gene YMR255W was inactivated by one-step gene replacement and the disrupted strain was viable and unaffected in its ability to grow in a variety of different test media such as minimal or complete media using eight distinct carbon sources at three pH values and temperatures. Inactivation of this gene also did not affect mating or sporulation

Overexpression of Salmonella enterica serovar Typhi recA gene confers fluoroquinolone resistance in Escherichia coli DH5α

A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α.

Breeding, genetic and genomic of citrus for disease resistance

Although the citriculture is one of the most important economic activities in Brazil, it is based on a small number of varieties. This fact has contributed for the vulnerability of the culture regarding the phytosanitary problems. A higher number of varieties/genotypes with potential for commercial growing, either for the industry or fresh market, has been one of the main objectives of citrus breeding programs. The genetic breeding of citrus has improved, in the last decades, due to the possibility of an association between biotechnological tools and classical methods of breeding. The use of molecular markers for early selection of zygotic seedlings from controlled crosses resulted in the possibility of selection of a high number of new combination and, as a consequence, the establishment of a great number of hybrids in field experiments. The faster new tools are incorporated in the program, the faster is possibility to reach new genotypes that can be tested as a new variety. Good traits should be kept or incorporate, whereas bad traits have to be excluded or minimized in the new genotype. Scion and rootstock can not be considered separately, and graft compatibility, fruit quality and productivity are essential traits to be evaluated in the last stages of the program. The mapping of QTLs has favored breeding programs of several perennial species and in citrus it was possible to map several characteristics with qualitative and quantitative inheritance. The existence of linkage maps and QTLs already mapped, the development of EST and BAC library and the sequencing of the Citrus complete genome altogether make very demanding and urgent the exploration of such data to launch a wider genetic study of citrus. The rising of information on genome of several organisms has opened new approaches looking for integration between breeding, genetic and genome. Genome assisted selection (GAS) involves more than gene or complete genome sequencing and is becoming an import support in breeding programs of annual and perennial species. An huge information amount can be derivate from genome analysis. The use and benefit of such informations will depend on the genetic basis of the breeding program.

Genomic characterization of adenovirus serotype 7 isolated in Brazil from acute respiratory disease patients during the period from 1980 to 1991

Forty isolates of adenovirus type 7 were analized by restriction enzyme digestion with BamHI, SmaI, EcoRI and HindIII. These isolates were obtained from acute respiratory disease patients during the years 1980 to 1991. Only two genomic types were found: Ad7b and Ad7e, with Ad7b (87.5%) being more frequent than Ad7e (12.5%). The genomic type Ad7e appeared in the years 1980, 1981 and 1983. Ad7b appeared in 1982 and it was the only genomic type found from 1984 to 1991. Both genomic types were responsible for lower (LRTI) and upper (URTI) respiratory tract infection, but the proportion LRTI/URTI is higher for Ad7b (25/6) than for Ad7e (1/4).

Rapid Characterization of S. mansoni Expression Library Clones of Potential Interest

A S. mansoni adult worm cDNA expression library was screened with sera from baboons in a early phase after infection. The clones that were positive with the early infection sera were examined for reactivity with pre-infection sera and heterologous infection sera. In order to discriminate a positive antibody reaction from the reactivity due to residual anti-E. coli antibodies, an unrelated cDNA clone was plated with the positive clone. The unrelated clone provided the negative background and the contrast necessary to discern a positive antibody reaction. In this way, we were able to eliminate selected clones that were positive with the pre-infection sera or heterologous infection sera. This characterization of the expression library clones enabled us to quickly target only clones with the desired pattern of antibody reactivity for sequencing, subcloning, and expressing

Molecular analysis of the dengue virus type 1 and 2 in Brazil based on sequences of the genomic envelope-nonstructural protein 1 junction region

The genomic sequences of the Envelope-Non-Structural protein 1 junction region (E/NS1) of 84 DEN-1 and 22 DEN-2 isolates from Brazil were determined. Most of these strains were isolated in the period from 1995 to 2001 in endemic and regions of recent dengue transmission in São Paulo State. Sequence data for DEN-1 and DEN-2 utilized in phylogenetic and split decomposition analyses also include sequences deposited in GenBank from different regions of Brazil and of the world. Phylogenetic analyses were done using both maximum likelihood and Bayesian approaches. Results for both DEN-1 and DEN-2 data are ambiguous, and support for most tree bipartitions are generally poor, suggesting that E/NS1 region does not contain enough information for recovering phylogenetic relationships among DEN-1 and DEN-2 sequences used in this study. The network graph generated in the split decomposition analysis of DEN-1 does not show evidence of grouping sequences according to country, region and clades. While the network for DEN-2 also shows ambiguities among DEN-2 sequences, it suggests that Brazilian sequences may belong to distinct subtypes of genotype III.

Characterization of a clone from an adult worm cDNA library selected with anti-Schistosoma mansoni human antibodies dissociated from immune complexes: a preliminary report

Considering the scarcity of defined antigens, actually useful and reliable for use in the field studies, we propose an alternative method for selection of cDNA clones with potential use in the diagnosis of schistosomiasis. Human antibodies specific to a protein fraction of 31/32 kDa (Sm31/32), dissociated from immune complexes, are used for screening of clones from an adult worm cDNA library. Partial sequencing of five clones, selected through this strategy, showed to be related to Schistosoma mansoni: two were identified as homologous to heat shock protein 70, one to glutathione S-transferase, one to homeodomain protein, and one to a previously described EST (expressed sequence tag) of S. mansoni. This last clone was the most consistently reactive during the screening process with the anti-Sm31/32 antibodies dissociated from the immune complexes. The complete sequence of this clone was obtained and the translation data yielded only one ORF (open reading frame) that code for a protein with 57 amino acids. Based on this amino acid sequence two peptides were chemically synthesized and evaluated separately against a pool of serum samples from schistosomiasis patients and non-schistosomiasis individuals. Both peptides showed strong reactivity only against the positive pool, suggesting that these peptides may be useful as antigens for the diagnosis of schistosomiasis mansoni.