Increase of a Calcium Independent Transglutaminase Activity in the Erythrocyte during the Infection with Plasmodium falciparum

We have studied the activity of a calcium dependent transglutaminase (EC 2.3.2.13) during the growth of the parasite Plasmodium falciparum inside the infected human erythrocyte. There is only one detectable transglutaminase in the two-cell-system, and its origin is erythrocytic. No activity was detected in preparations of the parasite devoid of erythrocyte cytoplasm. The Michaelis Menten constants (Km) of the enzyme for the substrates N'N'dimethylcaseine and putrescine were undistinguishable whether the cell extracts used in their determination were obtained from normal or from infected red cells. The total activity of transglutaminase in stringently synchronized cultures, measured at 0.5mM Ca2+, decreased with the maturation of the parasite. However, a fraction which became irreversibly activated and independent of calcium concentration was detected. The proportion of this fraction grew with maturation; it represented only 20% of the activity in 20 hr-old-trophozoites while in 48-hr-schizonts it was more than 85% of the total activity. The activation of this fraction of transglutaminase did not depend on an increase in the erythrocyte cytoplasmic calcium, since most of the calcium was shown to be located in the parasite.

Tissue transglutaminase (TG2) activity regulates osteoblast differentiation and mineralization in the SAOS-2 cell line

Tissue transglutaminase (type II, TG2) has long been postulated to directly promote skeletal matrix calcification and play an important role in ossification. However, limited information is available on the expression, function and modulating mechanism of TG2 during osteoblast differentiation and mineralization. To address these issues, we cultured the well-established human osteosarcoma cell line SAOS-2 with osteo-inductive conditioned medium and set up three time points (culture days 4, 7, and 14) to represent different stages of SAOS-2 differentiation. Osteoblast markers, mineralization, as well as TG2 expression and activity, were then assayed in each stage. Furthermore, we inhibited TG activity with cystamine and then checked SAOS-2 differentiation and mineralization in each stage. The results showed that during the progression of osteoblast differentiation SAOS-2 cells presented significantly high levels of osteocalcin (OC) mRNA, bone morphogenetic protein-2 (BMP-2) and collagen I, significantly high alkaline phosphatase (ALP) activity, and the increased formation of calcified matrix. With the same tendency, TG2 expression and activity were up-regulated. Furthermore, inhibition of TG activity resulted in a significant decrease of OC, collagen I, and BMP-2 mRNA and of ALP activity and mineralization. This study demonstrated that TG2 is involved in osteoblast differentiation and may play a role in the initiation and regulation of the mineralization processes. Moreover, the modulating effects of TG2 on osteoblasts may be related to BMP-2.

Raw-appearing Restructured fish models made with Sodium alginate or Microbial transglutaminase and effect of chilled storage

Restructuring by adding Sodium Alginate or Microbial Transglutaminase (MTGase) using cold gelation technology make it possible to obtain many different raw products from minced and/or chopped fish muscle that are suitable for being used as the basis of new restructured products with different physicochemical properties and even different compositions. Special consideration must be given to their shelf-life and the changes that may take place during chilling, both in visual appearance and physicochemical properties. After chilled storage, the restructured models made with different muscular particle size and composition at low temperature (5 °C), it was observed that microbial growth limited the shelf-life to 7-14 days. Mechanical properties increased (p < 0.05) during that time, and higher values were observed in samples elaborated by joining small muscle particle size than in those elaborated by homogenization. There was no clear increase in the cooking yield and purge loss, and no significant colour change (p > 0.05) was detected during storage.

The effect of relative humidity on tensile strength and water vapor permeability in chitosan, fish gelatin and transglutaminase edible films

Abstract Composite films of chitosan, fish gelatin and microbial transglutaminase (MTgase) were developed. Films were produced by the casting method and dried at room temperature for 30 h, conditioned for 7 days at 30 °C at a relative humidity (RH) from 11 to 90%, and characterized. Chitosan:fish gelatin films in different proportions (100:0, 75:25, 50:50) with MTgase, were subjected to tensile properties and water vapor transmission (WVT) testing. The results showed that tensile strength decreased with an increase in RH and with an increase in gelatin content. Percent of elongation also increased with increasing RH and gelatin concentration. Water vapor transmission showed an increase proportional to an increase in RH with the presence of gelatin being unfavorable for reducing WVT. Results in this work allowed studying the effect of relative humidity on tensile and water vapor properties of chitosan and fish gelatin films.

Autoantibody profile in individuals with chronic hepatitis C

IntroductionAutoantibodies are often produced during infection with chronic hepatitis C virus (HCV), but it remains controversial whether they influence the biochemical profile and histological features of this disease. Therefore, this current study sought to describe these autoantibodies and evaluate their impact on the clinical and histological presentation of hepatitis C.MethodsThis cross-sectional analytical study assessed patients with HCV (RNA+) from October 2011 to July 2012.ResultsThis study included 66 patients, with a mean age of 53.2±10.5 years. Of these patients, 60.6% were male, and 54.3% presented with genotype 1. Non-organ-specific autoantibodies (NOSA) were detected in 24% of the patients; of these, 7.6% were anti-mitochondrial antibodies (AMA+), 26.7% were anti-smooth muscle antibodies (SMA+) and 6.8% were liver kidney microsomal type 1 antibodies (LKM1+). With respect to the thyroid autoantibodies, 7.4% were anti-peroxidase (ATPO+) antibodies, and none were anti-thyroglobulin (ATG+) antibodies. Regarding celiac disease autoantibodies, 5.8% were endomysial antibodies (EMA+), and no transglutaminase (TTG+) antibodies were detected. Cryoglobulins were found in 2.1% of patients. When NOSA+ individuals were compared to patients without the presence of NOSAs, they exhibited higher median alkaline phosphatase (0.7 vs. 0.6 xULN; p=0.041), lower median platelet counts (141,500.0 vs. 180,500.0/mm3; p=0.036), lower mean prothrombin activity (72.6±11.5% vs. 82.2±16.0%; p=0.012) and an increased prevalence of significant fibrosis (E≥2) (45.5% vs. 18.2%; p=0.012). There was also a tendency for a greater proportion of NOSA+ cases to have marked periportal activity (APP≥3) (44.5% vs. 15.6%; p=0.087).ConclusionsIn addition to the high prevalence of autoantibodies associated with HCV infection, it was observed that NOSA positivity was associated with a more severe histological and biochemical profile of hepatitis C infection.

Prevalence and clinical features of celiac disease in patients with hepatitis B virus infection in Southern Brazil

Introduction Celiac disease is an autoimmune disorder that involves gluten intolerance and can be triggered by environmental factors including hepatitis B virus (HBV) infection. This study aimed to describe the prevalence of celiac disease in individuals with HBV infection and to describe the clinical and laboratory characteristics of celiac disease associated with HBV. Methods This cross-sectional study included 50 hepatitis B patients tested for IgA anti-endomysial antibodies (EMAs) and tissue anti-transglutaminase (TTG) between August 2011 and September 2012. Results Fifty patients were included with a mean age of 46.0 ± 12.6 (46.0) years; 46% were female and 13% were HBeAg+. Six patients had positive serology for celiac disease, four were EMA+, and five were TTG+. When individuals with positive serology for celiac disease were compared to those with negative serology, they demonstrated a higher prevalence of abdominal pain (100% vs. 33.3%, p = 0.008), lower median creatinine (0.7mg/dL vs. 0.9mg/dL, p = 0.007) and lower mean albumin (3.6 ± 0.4g/L vs. 3.9 ± 0.3g/L, p = 0.022). All individuals with positive serology for celiac disease underwent upper digestive endoscopy, and three of the patients exhibited a macroscopic pattern suggestive of celiac disease. Histologically, five patients demonstrated an intra-epithelial lymphocytic infiltrate level > 30%, and four patients showed villous atrophy associated with crypt hyperplasia on duodenal biopsy. Conclusions An increased prevalence of celiac disease was observed among hepatitis B patients. These patients were symptomatic and had significant laboratory abnormalities. These results indicate that active screening for celiac disease among HBV-infected adults is warranted.

Endogenous and exogenously-induced immunomodulation of tumour-host responsiveness

In spite of the availability of multiple effector mechanisms of the immune system to combat tumour growth and metastases, their impairment frequently accompanies the appearance of cancer. Factors contributing to this impairment may be related to properties of the host and/or the tumour itself and may be with respect to their origin -endogenous or exogenour. Based on the unique biological behavior of prostate cancer (PCa), and its apparent escape from immune surveillance in the presence of tumour immuno genicity, continuing investigation of endogenous and exogenous factors thought to be relevant to its pathogenesis have been made. For this purpose further studies of the suggested role of human seminal plasma (SePl) and the synthetic oestrogen, diethylstiboestrol (DES), as representative endogenous and exogenous immunomodulatory factors (IMF) of tumour-host responsiveness, together with evaluation of human prostatic tissue extracts and leuprolide (the luteinizing-hormone-releasing-hormone proposed as an alternate to DES therapy) have been made by evaluating their effect on the lytic activity of natural killer (NK) cells. SePl and prostate extracts significantly suppressed NK cell lysis. Physicochemical studies suggest SePl and prostate IMF to be associated with high and low molecular weight macromolecules; and implicate the participation of transglutaminase and prostaglandins. Comparative study of therapeutic levels of DES vs. leuprolide on NK cell lysis demonstrated significant suppression by DES vs. a negligible effect of leuprolide. Metastases are highly prevalent in PCa, and contribute significantly to its morbidity and mortality. Further knowledge of the range of effects of endogenous and exogenous IMF on effector mechanisms of tumour-host responsiveness, to include suppression of NK cells, and elucidation of their nature, may contribute toward our understanding of the unique biological behavior of tumours of the prostate, in addition to improvement in their clinical management.

An ultrasound and histomorphological analysis of experimental liver cirrhosis in rats

We investigated whether liver injury by dual exposure to ethanol and carbon tetrachloride (EtOH + CCl4) for 15 weeks would persist after hepatotoxic agents were removed (EtOH + CCl4/8wR). After 15 weeks of hepatic injury with ethanol (5.5%, m/v) and carbon tetrachloride (0.05, mL/kg, ip), 5 of 11 female Wistar rats were sacrificed. The other 6 rats were maintained for an additional 8 weeks without hepatotoxic agents. Ultrasonography showed increased liver echogenicity and dilation of portal vein caliber in both groups (EtOH + CCl4: 0.22 ± 0.01 cm, P < 0.001; EtOH + CCl4/8wR: 0.21 ± 0.02 cm, P < 0.01) vs control (0.16 ± 0.02 cm). Histopathology showed regenerative nodules in both experimental groups. Histomorphometry revealed increased fibrosis content in both groups (EtOH + CCl4: 12.6 ± 2.64%, P < 0.001; EtOH + CCl4/8wR: 10.4 ± 1.36%, P < 0.05) vs control (2.2 ± 1.21%). Collagen types I and III were increased in groups EtOH + CCl4 (collagen I: 2.5 ± 1.3%, P < 0.01; collagen III: 1.3 ± 0.2%, P < 0.05) and EtOH + CCl4/8wR (collagen I: 1.8 ± 0.06%, P < 0.05; collagen III: 1.5 ± 0.8%, P < 0.01) vs control (collagen I: 0.38 ± 0.11%; collagen III: 0.25 ± 0.06%). Tissue transglutaminase increased in both groups (EtOH + CCl4: 66.4 ± 8%, P < 0.01; EtOH + CCl4/8wR: 58.8 ± 21%, P < 0.01) vs control (7.9 ± 0.8%). Cirrhosis caused by the association of CCl4-EtOH remained for at least 8 weeks after removal of these hepatotoxic agents. Ultrasound images can be a useful tool to evaluate advanced hepatic alterations.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Efeito do tratamento térmico e enzimático nas propriedades de filmes de gelatina

Dentre os fatores que afetam a atividade da enzima transglutaminase, a temperatura de reação ou incubação é um fator determinante no grau de reticulação. Por outro lado, para a gelatina, tipicamente a rede estrutural polimérica é estabilizada por forças secundárias, sendo que a formação da matriz polimérica envolve um delicado balanço entre interações polímero-polímero e polímero-solvente, e este balanço é fortemente dependente do histórico térmico da solução. Desta forma, o objetivo deste trabalho foi avaliar o efeito da temperatura na reação de modificação enzimática em relação às propriedades funcionais dos filmes modificados à base de gelatina (propriedades mecânicas, de barreira ao vapor de água, solubilidade em água e parâmetros de cor dos filmes). Viscosidade aparente das soluções filmogênicas foram também avaliadas. Foram produzidos filmes denominados nativo (FN), modificado enzimaticamente (FME) e termicamente tratado (FC). De acordo com os resultados obtidos, observou-se que a temperatura de reação não afetou as propriedades mecânicas e a solubilidade dos diferentes filmes estudados. Por outro lado, filmes modificados enzimaticamente (FME) na temperatura de 50 °C apresentaram permeabilidade ao vapor de água significantemente inferior aos produzidos nas demais temperaturas e tratamentos (FN e FC). O tratamento térmico também provocou redução da permeabilidade ao vapor de água.

Aplicação de filmes proteicos à base de soro de leite

A eficiência da aplicação de filmes à base de proteínas de soro de leite foi avaliada em um sistema de embalagem que consistia em um pote plástico utilizando-se filmes de proteínas de soro de leite como fechamento superior. Pedaços de maçã foram embalados e armazenados à temperatura ambiente (25 °C) e sob refrigeração (10 °C). Os filmes proteicos à base de soro de leite foram obtidos por três procedimentos distintos: por desnaturação térmica; com a incorporação de ácido esteárico (0,5%, em massa); e por modificação enzimática utilizando-se a transglutaminase microbiana (10U/g proteína, ACTIVA TG-B ), a partir de uma formulação básica de 6,50% de proteína, 3,0% de plastificante (glicerol) e pH 7,0. A integridade dos filmes após embalagem e durante armazenamento foi observada, medindo-se as propriedades mecânicas dos filmes. A permeabilidade ao vapor d'água foi avaliada pela perda de massa, teor de umidade, e variação de textura dos pedaços de maçã. Os resultados indicaram que os filmes apresentam uma barreira moderada à umidade, apresentando diferença entre potes com e sem coberturas de filmes. A permeabilidade ao oxigênio foi conferida pelo escurecimento enzimático das maçãs pela ação da enzima polifenoxidase, apresentando diferença em relação ao das amostras acondicionadas em atmosfera modificada com gás N2.

Método acelerado de processamento de presunto cru

Nos métodos tradicionais de elaboração de presunto cru usa-se o pernil suíno inteiro, diferentemente da metodologia proposta neste trabalho, que combinou desossa, adição de transglutaminase, massageamento e moldagem das peças previamente à secagem e maturação, objetivando reduzir o tempo de processamento do produto. Avaliaram-se os efeitos de dois teores de NaCl adicionados (T1 - 3,5% e T2 - 5%), sobre características físico-químicas e microbiológicas dos presuntos crus ao longo do processo, além da avaliação sensorial dos produtos finais. Os presuntos crus obtidos atenderam aos padrões físico-químicos e microbiológicos determinados na legislação brasileira e não foram encontradas diferenças significativas (p < 0,05) entre os tratamentos quanto aos parâmetros avaliados no decorrer do processo e no produto final, com exceção da perda de peso, que foi maior em T1 (39,74 ± 4,02%) do que em T2 (37,22 ± 2,96%). Os presuntos crus desenvolvidos apresentaram formato e espessura apropriados para o fatiamento, excelente aparência, aroma característico e um sabor considerado muito próximo ao dos presuntos crus tradicionais comumente encontrados no mercado brasileiro, obtendo em torno de 80% de aceitação pelos consumidores.

Microparticles obtained by complex coacervation: influence of the type of reticulation and the drying process on the release of the core material

Microparticles obtained by complex coacervation were crosslinked with glutaraldehyde or with transglutaminase and dried using freeze drying or spray drying. Moist samples presented Encapsulation Efficiency (%EE) higher than 96%. The mean diameters ranged from 43.7 ± 3.4 to 96.4 ± 10.3 µm for moist samples, from 38.1 ± 5.36 to 65.2 ± 16.1 µm for dried samples, and from 62.5 ± 7.5 to 106.9 ± 26.1 µm for rehydrated microparticles. The integrity of the particles without crosslinking was maintained when freeze drying was used. After spray drying, only crosslinked samples were able to maintain the wall integrity. Microparticles had a round shape and in the case of dried samples rugged walls apparently without cracks were observed. Core distribution inside the particles was multinuclear and homogeneous and core release was evaluated using anhydrous ethanol. Moist particles crosslinked with glutaraldehyde at the concentration of 1.0 mM.g-1 protein (ptn), were more efficient with respect to the core retention compared to 0.1 mM.g-1 ptn or those crosslinked with transglutaminase (10 U.g-1 ptn). The drying processes had a strong influence on the core release profile reducing the amount released to all dry samples