Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Characterization of new Schistosoma mansoni microsatellite loci in sequences obtained from public DNA databases and microsatellite enriched genomic libraries

In the last decade microsatellites have become one of the most useful genetic markers used in a large number of organisms due to their abundance and high level of polymorphism. Microsatellites have been used for individual identification, paternity tests, forensic studies and population genetics. Data on microsatellite abundance comes preferentially from microsatellite enriched libraries and DNA sequence databases. We have conducted a search in GenBank of more than 16,000 Schistosoma mansoni ESTs and 42,000 BAC sequences. In addition, we obtained 300 sequences from CA and AT microsatellite enriched genomic libraries. The sequences were searched for simple repeats using the RepeatMasker software. Of 16,022 ESTs, we detected 481 (3%) sequences that contained 622 microsatellites (434 perfect, 164 imperfect and 24 compounds). Of the 481 ESTs, 194 were grouped in 63 clusters containing 2 to 15 ESTs per cluster. Polymorphisms were observed in 16 clusters. The 287 remaining ESTs were orphan sequences. Of the 42,017 BAC end sequences, 1,598 (3.8%) contained microsatellites (2,335 perfect, 287 imperfect and 79 compounds). The 1,598 BAC end sequences 80 were grouped into 17 clusters containing 3 to 17 BAC end sequences per cluster. Microsatellites were present in 67 out of 300 sequences from microsatellite enriched libraries (55 perfect, 38 imperfect and 15 compounds). From all of the observed loci 55 were selected for having the longest perfect repeats and flanking regions that allowed the design of primers for PCR amplification. Additionally we describe two new polymorphic microsatellite loci.

Obtaining interspecific hybrids, and molecular analysis by microsatellite markers in grapevine

The objective of this work was to assess the potential of interspecific hybridization of Vitis labruscana and Muscadinia rotundifolia by using artificial cross-pollinations. Microsatellite markers were used to confirm interspecific hybridizations and the identity of the parental genotypes. In crosses in which M. rotundifolia was used as the female parent, no true hybrids were obtained. In the reciprocal crosses, 114 seedlings were identified as true V. labruscana x M. rotundifolia hybrids. Self pollination occurred in direct and in reciprocal crosses. The crossings between 'Bordo' x 'Carlos', 'Magnolia', 'Regale' and' Roanoke', and between' Isabel' x 'Bountiful', 'Carlos', 'Magnolia', 'Regale' and 'Roanoke' were confirmed. The 15 markers evaluated showed that two M. rotundifolia parental genotypes had the same fingerprint profile, indicating a like lyplanting error. The success of hybridization depends mainly on the species and on the cultivar used as the female parent. Microsatellite markers are efficient to confirm the paternity of interspecific F1 hybrids and to determine the correct identity of M. rotundifolia cultivars.

Mating system parameters in a high density population of andirobas in the Amazon forest

The objective of this work was to estimate the mating system parameters of a andiroba (Carapa guianensis) population using microsatellite markers and the mixed and correlated mating models. Twelve open‑pollinated progeny arrays of 15 individuals were sampled in an area with C. guianensis estimated density of 25.7 trees per hectare. Overall, the species has a mixed reproductive system, with a predominance of outcrossing. The multilocus outcrossing rate (t m = 0.862) was significantly lower than the unity, indicating that self‑pollination occurred. The rate of biparental inbreeding was substantial (t m ‑ t s = 0.134) and significantly different from zero. The correlation of selfing within progenies was high (r s = 0.635), indicating variation in the individual outcrossing rate. Consistent with this result, the estimate of the individual outcrossing rate ranged from 0.598 to 0.978. The multilocus correlation of paternity was low (r p(m) = 0.081), but significantly different from zero, suggesting that the progenies contain full‑sibs. The coancestry within progenies (Θ = 0.185) was higher and the variance effective size (Ne(v) = 2.7) was lower than expected for true half‑sib progenies (Θ = 0.125; Ne(v) = 4). These results suggest that, in order to maintain a minimum effective size of 150 individuals for breeding, genetic conservation, and environmental reforestation programs, seeds from at least 56 trees must be collected.

Mating system in Myracrodruon urundeuva (Anarcadiaceae): implications for conservation genetics

The aims of this study were to investigate the mating system of a fragmented population of the dioecious tropical tree Myracrodruon urundeuva Allemão, using five microsatellite loci and the mixed mating and correlated mating models. The study was conducted in the Estação Ecológica de Paulo de Farias (436 ha), where the population occupies about 142 ha. The mating system was estimated using 514 open-pollinated offspring, collected from 30 seed-trees. Estimates of the multilocus outcrossing rate confirm that the species is dioecious (t m = 1.0). Low levels of mating among relatives were detected in the population (1 - t s = 0.020). The estimate of paternity correlation (r p(m)) indicated that offsprings were composed of mixtures of half-sibs and full-sibs, with the latter occurring at a low frequency (average of 0.148). The estimated coancestry coefficient within families (Θ = 0.147) was larger and the effective population size (Ne(v)) was lower (Ne(v) = 2.98) than expected in progenies from panmictic populations (Θ = 0.125, Ne(v) = 4, respectively). In terms of conservation, the results indicate that to retain an effective population size of 150, is necessary to collect seeds from at least 50 seed-trees.