High baseline serum total and LDL cholesterol levels are associated with MDR1 haplotypes in Brazilian hypercholesterolemic individuals of European descent

The MDR1 gene encodes the P-glycoprotein, an efflux transporter with broad substrate specificity. P-glycoprotein has raised great interest in pharmacogenetics because it transports a variety of structurally divergent drugs, including lipid-lowering drugs. The synonymous single-nucleotide polymorphism C3435T and the nonsynonymous single-nucleotide polymorphism G2677T/A in MDR1 have been indicated as potential determinants of variability in drug disposition and efficacy. In order to evaluate the effect of G2677T/A and C3435T MDR1 polymorphisms on serum levels of lipids before and after atorvastatin administration, 69 unrelated hypercholesterolemic individuals from São Paulo city, Brazil, were selected and treated with 10 mg atorvastatin orally once daily for four weeks. MDR1 polymorphisms were analyzed by PCR-RFLP. C3435T and G2677T polymorphisms were found to be linked. The allelic frequencies for C3435T polymorphism were 0.536 and 0.464 for the 3435C and 3435T alleles, respectively, while for G2677T/A polymorphism allele frequencies were 0.580 for the 2677G allele, 0.384 for the 2677T allele and 0.036 for the 2677A allele. There was no significant relation between atorvastatin response and MDR1 polymorphisms (repeated measures ANOVA; P > 0.05). However, haplotype analysis revealed an association between T/T carriers and higher basal serum total (TC) and LDL cholesterol levels (TC: 303 ± 56, LDL-C: 216 ± 57 mg/dl, respectively) compared with non-T/T carriers (TC: 278 ± 28, LDL-C: 189 ± 24 mg/dl; repeated measures ANOVA/Tukey test; P < 0.05). These data indicate that MDR1 polymorphism may have an important contribution to the control of basal serum cholesterol levels in Brazilian hypercholesterolemic individuals of European descent.

Spectral analysis of the electromyograph of the erector spinae muscle before and after a dynamic manual load-lifting test

The aim of the present study was to assess the spectral behavior of the erector spinae muscle during isometric contractions performed before and after a dynamic manual load-lifting test carried out by the trunk in order to determine the capacity of muscle to perform this task. Nine healthy female students participated in the experiment. Their average age, height, and body mass (± SD) were 20 ± 1 years, 1.6 ± 0.03 m, and 53 ± 4 kg, respectively. The development of muscle fatigue was assessed by spectral analysis (median frequency) and root mean square with time. The test consisted of repeated bending movements from the trunk, starting from a 45º angle of flexion, with the application of approximately 15, 25 and 50% of maximum individual load, to the stand up position. The protocol used proved to be more reliable with loads exceeding 50% of the maximum for the identification of muscle fatigue by electromyography as a function of time. Most of the volunteers showed an increase in root mean square versus time on both the right (N = 7) and the left (N = 6) side, indicating a tendency to become fatigued. With respect to the changes in median frequency of the electromyographic signal, the loads used in this study had no significant effect on either the right or the left side of the erector spinae muscle at this frequency, suggesting that a higher amount and percentage of loads would produce more substantial results in the study of isotonic contractions.

Response to an oral calcium load in nephrolithiasis patients with fluctuating parathyroid hormone and ionized calcium levels

the response to an oral calcium load test was assessed in 17 hypercalciuric nephrolithiasis patients who presented elevated parathyroid hormone (PTH) irrespective of the ionized calcium (sCa2+) levels. Blood samples were collected at baseline (0 min) and at 60 and 180 min after 1 g calcium load for serum PTH, total calcium, sCa2+, and 1.25(OH)2D3 determinations. According to the sCa2+ level at baseline, patients were classified as normocalcemic (N = 9) or hypercalcemic (N = 8). Six healthy subjects were also evaluated as controls. Bone mineral density was reduced in 14/17 patients. In the normocalcemic group, mean PTH levels at 0, 60 and 180 min (95 ± 76, 56 ± 40, 57 ± 45 pg/ml, respectively) did not differ from the hypercalcemic group (130 ± 75, 68 ± 35, 80 ± 33 pg/ml) but were significantly higher compared to healthy subjects despite a similar elevation in sCa2+ after 60 and 180 min vs baseline in all 3 groups. Mean total calcium and 1.25(OH)2D3 were similar in the 3 groups. Additionally, we observed that 5 of 9 normocalcemic patients presented a significantly higher concentration-time curve for serum PTH (AUC0',60',180') than the other 4 patients and the healthy subjects, suggesting a primary parathyroid dysfunction. These data suggest that the individual response to an oral calcium load test may be a valuable dynamic tool to disclose a subtle primary hyperparathyroidism in patients with high PTH and fluctuating sCa2+ levels, avoiding repeated measurements of both parameters.

Changes in the biogenic amine content of the prefrontal cortex, amygdala, dorsal hippocampus, and nucleus accumbens of rats submitted to single and repeated sessions of the elevated plus-maze test

It has been demonstrated that exposure to a variety of stressful experiences enhances fearful reactions when behavior is tested in current animal models of anxiety. Until now, no study has examined the neurochemical changes during the test and retest sessions of rats submitted to the elevated plus maze (EPM). The present study uses a new approach (HPLC) by looking at the changes in dopamine and serotonin levels in the prefrontal cortex, amygdala, dorsal hippocampus, and nucleus accumbens in animals upon single or double exposure to the EPM (one-trial tolerance). The study involved two experiments: i) saline or midazolam (0.5 mg/kg) before the first trial, and ii) saline or midazolam before the second trial. For the biochemical analysis a control group injected with saline and not tested in the EPM was included. Stressful stimuli in the EPM were able to elicit one-trial tolerance to midazolam on re-exposure (61.01%). Significant decreases in serotonin contents occurred in the prefrontal cortex (38.74%), amygdala (78.96%), dorsal hippocampus (70.33%), and nucleus accumbens (73.58%) of the animals tested in the EPM (P < 0.05 in all cases in relation to controls not exposed to the EPM). A significant decrease in dopamine content was also observed in the amygdala (54.74%, P < 0.05). These changes were maintained across trials. There was no change in the turnover rates of these monoamines. We suggest that exposure to the EPM causes reduced monoaminergic neurotransmission activity in limbic structures, which appears to underlie the "one-trial tolerance" phenomenon.

RESISTANCE TO OXAMNIQUINE OF A Schistosoma mansoni STRAIN ISOLATED FROM PATIENT SUBMITTED TO REPEATED TREATMENTS

A strain of Schistosoma mansoni (R1) was isolated from patient previously submitted to four treatments with oxamniquine, and to another one with praziquantel. The results obtained with chemotherapeutic test, by using oxamniquine in mice infected with the strains R1 and LE (standard), showed an evident resistance to the drug in worms of the strain R1. Thus, at the dose of 250 mg/kg oxamniquine, all mice (17) infected with the LE strain did not show surviving worms, whereas 12 out of 17 mice infected with the R1 strain presented surviving worms. At the dose of 200 mg/kg, the LE strain showed recovery rates of 1.06% and 20.58%, whereas the R1 strain presented 18.57% and 61.14%, for male and female worms, respectively. At the dose of 100 mg/kg, the recovery of male worms was 2.6% for the LE strain, and 29.9% for the R1 strain. At the same dose, the recovery of females did not show statistically significant differences between the two strains (LE = 76.38%, R1 = 79.12%). Praziquantel showed similar antischistosomal activity against both studied strains, when administered at the dose of 500 mg/kg

Rapid HIV diagnostic test in undocumented pregnant women applied at an inner-city teaching hospital

A significant number of Brazilian gestational-age women are still not tested for HIV, representing a high risk of transmission to their newborns. The current study sought to identify the number of pregnant women with no previous testing or undocumented for HIV referred to the Gynecology and Obstetrics Department of a Regional Teaching Hospital and included diagnosis of HIV infection determined by a rapid test and perinatal transmission in pregnancy. Medical records of all pregnant women admitted to hospital from January 2001 to December 2005 were reviewed. Pregnant women without HIV results were submitted to a rapid HIV test. Those who tested positive were further tested by ELISA and confirmed by indirect immunofluorescence assay (IIA) or Western blot (WB). The viral load from babies born to HIV-infected mothers was assessed by bDNA. Of the 16,424 pregnant women analyzed (6.6%), 1,089 were undocumented for HIV. Eleven women were positive in rapid testing and 10 were confirmed by ELISA, IIA or WB, with 0.9% seropositivity. Mother/infant pairs received zidovudine monotherapy prophylaxis and infant viral load was lower than 50 copies/mL. A higher number of pregnant women previously tested for HIV during antenatal care was verified, compared to that obtained nationwide.

Soil compaction and eucalyptus growth in response to forwarder traffic intensity and load

During timber exploitation in forest stands harvesting machines pass repeatedly along the same track and can cause soil compaction, which leads to soil erosion and restricted tree root growth. The level of soil compaction depends on the number of passes and weight of the wood load. This paper aimed to evaluate soil compaction and eucalyptus growth as affected by the number of passes and wood load of a forwarder. The study was carried out in Santa Maria de Itabira county, Minas Gerais State - Brazil, on a seven-year-old eucalyptus stand planted on an Oxisol. The trees were felled by chainsaw and manually removed. Plots of 144 m² (four rows 12 m long in a 3 x 2 m spacing) were then marked off for the conduction of two trials. The first tested the traffic intensity of a forwarder which weighed 11,900 kg and carried 12 m³ wood (density of 480 kg m-3) and passed 2, 4, and 8 times along the same track. In the second trial, the forwarder carried loads of 4, 8, and 12 m³ of wood, and the machine was driven four times along the same track. In each plot, the passes affected four rows. Eucalyptus was planted in 30 x 30 x 30 cm holes on the compacted tracks. The soil in the area is clayey (470 clay and 440 g kg-1 sand content) and at depths of 0-5 cm and 5-10 cm, respectively, soil organic carbon was 406 and 272 g kg-1 and the moisture content during the trial 248 and 249 g kg-1. These layers were assessed for soil bulk density and water-stable aggregates. The infiltration rate was measured by a cylinder infiltrometer. After 441 days the measurements were repeated, with additional analyses of: soil organic carbon, total nitrogen, N-NH4+, N-NO3-, porosity, and penetration resistance. Tree height, stem diameter, and stem dry matter were measured. Forwarder traffic increased soil compaction, resistance to penetration and microporosity while it reduced the geometric mean diameter, total porosity, macroporosity and infiltration rate. Stem dry matter yield and tree height were not affected by soil compaction. Two passes of the forwarder were enough to cause the disturbances at the highest levels. The compaction effects were still persistent 441 days after forwarder traffic.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Effect of repeated restraint stress on memory in different tasks

The present study investigated the effect of repeated stress applied to female rats on memory evaluated by three behavioral tasks: two-way shuttle avoidance, inhibitory avoidance and habituation to an open field. Repeated stress had different effects on rat behavior when different tasks were considered. In the two-way active avoidance test the stressed animals presented memory of the task, but their memory scores were impaired when compared to all other groups. In the habituation to the open field, only the control group showed a significant difference in the number of rearings between training and testing sessions, which is interpreted as an adequate memory of the task. In the handled and chronically stressed animals, on the other hand, no memory was observed, suggesting that even a very mild repeated stress would be enough to alter habituation to this task. The performance in the inhibitory avoidance task presented no significant differences between groups. The findings suggest that repeated restraint stress might induce cognitive impairments that are dependent on the task and on stress intensity.

Respiratory panic disorder subtype and sensitivity to the carbon dioxide challenge test

The aim of the present study was to verify the sensitivity to the carbon dioxide (CO2) challenge test of panic disorder (PD) patients with respiratory and nonrespiratory subtypes of the disorder. Our hypothesis is that the respiratory subtype is more sensitive to 35% CO2. Twenty-seven PD subjects with or without agoraphobia were classified into respiratory and nonrespiratory subtypes on the basis of the presence of respiratory symptoms during their panic attacks. The tests were carried out in a double-blind manner using two mixtures: 1) 35% CO2 and 65% O2, and 2) 100% atmospheric compressed air, 20 min apart. The tests were repeated after 2 weeks during which the participants in the study did not receive any psychotropic drugs. At least 15 of 16 (93.7%) respiratory PD subtype patients and 5 of 11 (43.4%) nonrespiratory PD patients had a panic attack during one of two CO2 challenges (P = 0.009, Fisher exact test). Respiratory PD subtype patients were more sensitive to the CO2 challenge test. There was agreement between the severity of PD measured by the Clinical Global Impression (CGI) Scale and the subtype of PD. Higher CGI scores in the respiratory PD subtype could reflect a greater sensitivity to the CO2 challenge due to a greater severity of PD. Carbon dioxide challenges in PD may define PD subtypes and their underlying mechanisms.

Determination of anaerobic threshold in rats using the lactate minimum test

The break point of the curve of blood lactate vs exercise load has been called anaerobic threshold (AT) and is considered to be an important indicator of endurance exercise capacity in human subjects. There are few studies of AT determination in animals. We describe a protocol for AT determination by the "lactate minimum test" in rats during swimming exercise. The test is based on the premise that during an incremental exercise test, and after a bout of maximal exercise, blood lactate decreases to a minimum and then increases again. This minimum value indicates the intensity of the AT. Adult male (90 days) Wistar rats adapted to swimming for 2 weeks were used. The initial state of lactic acidosis was obtained by making the animals jump into the water and swim while carrying a load equivalent to 50% of body weight for 6 min (30-s exercise interrupted by a 30-s rest). After a 9-min rest, blood was collected and the incremental swimming test was started. The test consisted of swimming while supporting loads of 4.5, 5.0, 5.5, 6.0 and 7.0% of body weight. Each exercise load lasted 5 min and was followed by a 30-s rest during which blood samples were taken. The blood lactate minimum was determined from a zero-gradient tangent to a spline function fitting the blood lactate vs workload curve. AT was estimated to be 4.95 ± 0.10% of body weight while interpolated blood lactate was 7.17 ± 0.16 mmol/l. These results suggest the application of AT determination in animal studies concerning metabolism during exercise.

Human T-cell lymphotropic virus type I (HTLV-I) proviral DNA viral load among asymptomatic patients and patients with HTLV-I-associated myelopathy/tropical spastic paraparesis

To evaluate the human T-cell lymphotropic virus type I (HTLV-I) proviral DNA load among asymptomatic HTLV-I-infected carriers and patients with HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP), real time PCR using TaqMan probes for the pol gene was performed in two million peripheral blood mononuclear cells (PBMC). The albumin gene was the internal genomic control and MT2 cells were used as positive control. The results are reported as copies/10,000 PBMC, and the detection limit was 10 copies. A total of 89 subjects (44 HAM/TSP and 45 healthy HTLV-I-infected carriers) followed up at the Institute of Infectious Diseases "Emilio Ribas" and in the Neurology Division of Hospital of Clínicas were studied. The asymptomatic HTLV-I-infected carriers had a median number of 271 copies (ranging from 5 to 4756 copies), whereas the HAM/TSP cases presented a median of 679 copies (5-5360 copies) in 10,000 PBMC. Thus, HAM/TSP patients presented a significantly higher HTLV-I proviral DNA load than healthy HTLV-I carriers (P = 0.005, one-way Mann-Whitney test). As observed in other persistent infections, proviral DNA load quantification may be an important tool for monotoring HTLV-I-infected subjects. However, long-term follow-up is necessary to validate this assay in the clinical setting.

Breathing pattern and thoracoabdominal motion during exercise in chronic obstructive pulmonary disease

Subjects with chronic obstructive pulmonary disease (COPD) present breathing pattern and thoracoabdominal motion abnormalities that may contribute to exercise limitation. Twenty-two men with stable COPD (FEV1 = 42.6 ± 13.5% predicted; age 68 ± 8 years; mean ± SD) on usual medication and with at least 5 years of diagnosis were evaluated at rest and during an incremental cycle exercise test (10 watts/2 min). Changes in respiratory frequency, tidal volume, rib cage and abdominal motion contribution to tidal volume and the phase angle that measures the asynchrony were analyzed by inductive respiratory plethysmography at rest and during three levels of exercise (30-50, 70-80, and 100% maximal work load). Repeated measures ANOVA followed by pre-planned contrasts and Bonferroni corrections were used for analyses. As expected, the greater the exercise intensity the higher the tidal volume and respiratory frequency. Abdominal motion contributed to the tidal volume increase (rest: 49.82 ± 11.19% vs exercise: 64.15 ± 9.7%, 63.41 ± 10%, and 65.56 ± 10.2%, respectively, P < 0.001) as well as the asynchrony [phase angle: 11.95 ± 7.24° at rest vs 22.2 ± 15° (P = 0.002), 22.6 ± 9° (P < 0.001), and 22.7 ± 8° (P < 0.001), respectively, at the three levels of exercise]. In conclusion, the increase in ventilation during exercise in COPD patients was associated with the major motion of the abdominal compartment and with an increase in the asynchrony independent of exercise intensity. It suggests that cycling exercise is an effective way of enhancing ventilation in COPD patients.

Antidepressant-like effect of Hoodia gordonii in a forced swimming test in mice: evidence for involvement of the monoaminergic system

Hoodia gordonii is a plant species used traditionally in southern Africa to suppress appetite. Recently, it has been associated with a significant increase in blood pressure and pulse rate in women, suggesting sympathomimetic activity. The present study investigated the possible antidepressant-like effects of acute and repeated (15 days) administration of H. gordonii extract (25 and 50 mg/kg, po) to mice exposed to a forced swimming test (FST). Neurochemical analysis of brain monoamines was also carried out to determine the involvement of the monoaminergic system on these effects. Acute administration of H. gordonii decreased the immobility of mice in the FST without accompanying changes in general activity in the open-field test during acute treatment, suggesting an antidepressant-like effect. The anti-immobility effect of H. gordonii was prevented by pretreatment of mice with PCPA [an inhibitor of serotonin (5-HT) synthesis], NAN-190 (a 5-HT1A antagonist), ritanserin (a 5-HT2A/2C antagonist), ondansetron (a 5-HT3A antagonist), prazosin (an α1-adrenoceptor antagonist), SCH23390 (a D1 receptor antagonist), yohimbine (an α2-adrenoceptor antagonist), and sulpiride (a D2 receptor antagonist). A significant increase in 5-HT levels in the striatum was detected after acute administration, while 5-HT, norepinephrine and dopamine were significantly elevated after chronic treatment. Results indicated that H. gordonii possesses antidepressant-like activity in the FST by altering the dopaminergic, serotonergic, and noradrenergic systems.

O uso do "Face-Hand Test" como instrumento para rastrear as síndromes psicorgânicas: estudo piloto

Foi aplicada uma versão reduzida do "Face-Hand Test", o FHT-R, em 91 pessoas com 65 anos ou mais em uma amostra ao acaso de idosos vivendo na comunidade (São Paulo, Brasil), com objetivo de testar a habilidade do instrumento em detectar as síndromes psicorgânicas. Os escores do FHT-R foram comparados com as avaliações de um psiquiatra utilizando uma entrevista semi-estruturada, a "Clinical Interview Schedule". Cinco pessoas foram consideradas como sendo portadoras de distúrbios psicorgânicos e 86 como não sendo portadoras de tais distúrbios. No ponto de corte 0/1 os coeficientes de validação obtidos foram: sensibilidade 60%, especificidade 94%, valor prognóstico positivo 38%, valor prognóstico negativo 98%, e taxa de classificação incorreta 8%. A utilização do Teste em pesquisas epidemiológicas é discutida no corpo do trabalho.