83 resultados para Recombination fingerprinting
em Scielo Saúde Pública - SP
Resumo:
Differences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting (RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individual characterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, were employed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction of symptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains. The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a high degree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved in the pathogenesis of amebiasis.
Resumo:
Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli) and four strains of E. granulosus (cattle, horse, pig and sheep strains) were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial) genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection) drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1). The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised
Resumo:
Extensive characterisation of Trypanosoma cruzi by isoenzyme phenotypes has separated the species into three principal zymodeme groups, Z1, Z2 and Z3, and into many individual zymodemes. There is marked diversity within Z2. A strong correlation has been demonstrated between the strain clusters determined by isoenzymes and those obtained using random amplified polymorphic DNA (RAPD) profiles. Polymorphisms in ribosomal RNA genes, in mini-exon genes, and microsatellite fingerprinting indicate the presence of at least two principal T. cruzi genetic lineages. Lineage 1 appears to correspond with Z2 and lineage 2 with Z1. Z1 (lineage 2) is associated with Didelphis. Z2 (lineage 1) may be associated with a primate host. Departures from Hardy-Weinberg equilibrium and linkage disequilibrium indicate that propagation of T. cruzi is predominantly clonal. Nevertheless, two studies show putative homozygotes and heterozygotes circulating sympatrically: the allozyme frequencies for phosphoglucomutase, and hybrid RAPD profiles suggest that genetic exchange may be a current phenomenon in some T. cruzi transmission cycles. We were able to isolate dual drug-resistant T. cruzi biological clones following copassage of putative parents carrying single episomal drug-resistant markers. A multiplex PCR confirmed that dual drug-resistant clones carried both episomal plasmids. Preliminary karyotype analysis suggests that recombination may not be confined to the extranuclear genome.
Resumo:
The standardized method to study the polymorphism of IS 6110 was used to characterize 53 isolates of Mycobacterium tuberculosis obtained during 1991-1992 from 14 regions in Colombia. In Valle region cluster rate was 25% (4/16). The mean number of IS6110 band was 10 ± 3. Similarity between strains was of 60% in 81% of strains and this tended to be correlated with geographic origin. For the first time M. tuberculosis without IS6110 bands in restriction fragment length polymorphism analysis was found in Colombia. Additional studies are necessaries in order to best characterize the situation in relation to human immunodeficiency virus epidemic and recent changes in tuberculosis control program.
Resumo:
The bacterial strain Bacillus cereus is closely related to Bacillus thuringiensis, although any genetic relationship between the two strains is still in debate. Using rep-PCR genomic fingerprinting, we established the genetic relationships between Brazilian sympatric populations of B. cereus and B. thuringiensis simultaneously collected from two geographically separate sites. We observed the formation of both B. thuringiensis and B. cereus clusters, as well as strains of B. cereus that are more closely related to B. thuringiensis than to other B. cereus strains. In addition, lower genetic variability was observed among B. thuringiensis clusters compared to B. cereus clusters, indicating that either the two species should be categorized as separate or that B. thuringiensis may represent a clone from a B. cereus background.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Partial nucleotide sequences of five tomato infecting Begomovirus isolates were determined from DNA-A fragments, corresponding to the 5' region of the replication associated protein gene, the intergenic region and the 5' region of the coat protein gene. Isolate DFM shared 95% identity with Tomato mottle leaf curl virus (TMoLCV), isolates 34, PA-05, and Ta4 were 88% identical to Tomato yellow vein streak virus and isolate DF-BR3 shared 77% identity with TMoLCV. Recombination analysis indicated that isolate DF-BR3 was a chimaera, and it provided evidence that there is a complex and actively recombining population of tomato infecting begomoviruses in Brazil.
Resumo:
The objective of this work was to determine the effect of male sterility or manual recombination on genetic variability of rice recurrent selection populations. The populations CNA-IRAT 4, with a gene for male sterility, and CNA 12, which was manually recombined, were evaluated. Genetic variability among selection cycles was estimated using14 simple sequence repeat (SSR) markers. A total of 926 plants were analyzed, including ten genitors and 180 individuals from each of the evaluated cycles (1, 2 and 5) of the population CNA-IRAT 4, and 16 genitors and 180 individuals from each of the cycles (1 and 2) of CNA 12. The analysis allowed the identification of alleles not present among the genitors for both populations, in all cycles, especially for the CNA-IRAT 4 population. These alleles resulted from unwanted fertilization with genotypes that were not originally part of the populations. The parameters of Wright's F-statistic (F IS and F IT) indicated that the manual recombination expands the genetic variability of the CNA 12 population, whereas male sterility reduces the one of CNA-IRAT 4.
Resumo:
The objective of this work was to evaluate the biochemical composition of six berry types belonging to Fragaria, Rubus, Vaccinium and Ribes genus. Fruit samples were collected in triplicate (50 fruit each) from 18 different species or cultivars of the mentioned genera, during three years (2008 to 2010). Content of individual sugars, organic acids, flavonols, and phenolic acids were determined by high performance liquid chromatography (HPLC) analysis, while total phenolics (TPC) and total antioxidant capacity (TAC), by using spectrophotometry. Principal component analysis (PCA) and hierarchical cluster analysis (CA) were performed to evaluate the differences in fruit biochemical profile. The highest contents of bioactive components were found in Ribes nigrum and in Fragaria vesca, Rubus plicatus, and Vaccinium myrtillus. PCA and CA were able to partially discriminate between berries on the basis of their biochemical composition. Individual and total sugars, myricetin, ellagic acid, TPC and TAC showed the highest impact on biochemical composition of the berry fruits. CA separated blackberry, raspberry, and blueberry as isolate groups, while classification of strawberry, black and red currant in a specific group has not occurred. There is a large variability both between and within the different types of berries. Metabolite fingerprinting of the evaluated berries showed unique biochemical profiles and specific combination of bioactive compound contents.
Resumo:
The objective of this work was to estimate the incidence and prevalence of Garlic common latent virus (GarCLV) in the main production regions of garlic (Allium sativum) in Argentina, and to perform phylogenetic and recombination analyses in isolates from these regions. Leaf samples (3,050) were taken from four garlic commercial types, in 13 departments of the four main garlic-producing provinces of Argentina, in a 1,175-ha sampling area. Virus infection was evaluated with DAS-Elisa test using specific antiserum, and the phylogenetic and recombination analyses were done with capsid protein (CP) nucleotide sequence of seven GarCLV isolates from the provinces. The incidence of GarCLV in the evaluated provinces varied between 6.7 and 22% of the samples, whereas the prevalence varied between 52.6 and 70%. In the analysis of garlic commercial types, Morado showed the highest incidence of the virus, in the province of San Juan, whereas Rosado Paraguayo had the lowest incidence, in the province of Cordoba. Nucleotide identity in the CP sequences ranged between 80.3 and 97.6%. The phylogenetic analysis shows the presence of two main groups of GarCLV and of a possible third group that would include only a German isolate. The recombination analysis between isolates from different parts of the world evidences the presence of recombinant isolates from Poland and Australia.
Resumo:
Bacterial canker of grapevine (Vitis vinifera), caused by Xanthomonas campestris pv. viticola was first detected in Brazil in 1998, affecting grapevines in the São Francisco river basin, state of Pernambuco. The disease was also reported in Juazeiro, Bahia and later in Piauí and Ceará. Due to its limited geographical distribution and relatively recent detection in Brazil, very little is known about the pathogen's biology and diversity. Repetitive DNA based-PCR (rep-PCR) profiles were generated from purified bacterial DNA of 40 field strains of X. campestris pv. viticola, collected between 1998 and 2001 in the states of Pernambuco, Bahia and Piauí. Combined analysis of the PCR patterns obtained with primers REP, ERIC and BOX, showed a high degree of similarity among Brazilian strains and the Indian type strain NCPPB 2475. Similar genomic patterns with several diagnostic bands, present in all strains, could be detected. Fingerprints were distinct from those of strains representing other pathovars and from a yellow non-pathogenic isolate from grape leaves. The polymorphism observed among the Brazilian strains allowed their separation into five subgroups, although with no correlation with cultivar of origin, geographic location or year collected.
Resumo:
In some literature variations in photosynthetic rates are considered to be of little relevance for individual fitness. This depends among other things on how one defines fitness, i.e. if one takes strictly Darwinian fitness as seed production or if one needs to evaluate particular traits and consider plant establishment. It also matters if one takes the Darwinian "organism individual" as the central entity in evolution ("individual fitness") or the "species individual" in a modified "Structure of Evolutionary Theory" sensu Stephen Jay Gould. A phenotypically expressed trait like photosynthetic rate, even if intra- and interspecific differences may be small, can matter in habitat performance and niche acquisition. Light dependence curves (LCs) of photosynthetic rates are now readily measured under field conditions using miniaturized equipment of pulse amplitude modulated fluorometers. In contrast to actual momentary measurements of quantum yield of photosynthesis under actually prevailing ambient conditions, LC measurements reflect the expressed intrinsic capacity of photosynthesis. In this review we explore the power of LC measurements yielding cardinal points such as maximum apparent electron transport rate of photosystem II (ETRmax) and saturating photosynthetically active radiation (PARsat) in making intra- and interspecific comparisons of plant performance and synecological fingerprinting in ecophysiological studies across species, sites, habitats and ecosystems.
Resumo:
Isolates of Mycobacterium tuberculosis derived from patients with AIDS from a single hospital in Rio de Janeiro were typed using a standardized RFLP technique detecting IS6110 polymorphism. Nineteen isolates were obtained from 15 different patients. Eleven distinct IS6110 patterns were found, with 4 banding patterns shared by 2 patients. The clustering value of 53% was much higher in comparison with clustering of M. tuberculosis strains from TB patients without clinical signs for HIV infection from randomly selected health centers. We present these results as preliminary data on M. tuberculosis strain polymorphism in Brazil and on the higher risk for recent transmission amongst patients with AIDS
Resumo:
The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA), developed by Heath et al. [Nucleic Acids Research (1993) 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel) specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.