Aggregatory behaviour of platelets incubated with subcellular fractions of normal and chagasic human syncytiotrophoblast

The surface of human syncytiotrophoblast does not induce maternal blood platelet aggregation even though it is not an endothelium. It can be surmised that as occurs in endothelial injury the subcellular components of the syncytiotrophoblast may have pro-or antiaggregatory activity. During congenital Chagas' disease which is associated to trophoblast lesions, platelets may play a role in the development of T. cruzi-induced placentitis. In the present work the aggregatory behaviour of normal human blood platelets was recorded after their challenging with subcellular fractions of syncytiotrophoblast isolated from normal and chagasic women. Nuclear, Mitochondrial, Microsomal and Supernatant fractions isolated from normal and chagasic syncytiotrophoblast failed to induce per se any aggregatory reaction on platelets. When samples of platelet-rich plasma (PRP) were preincubated with normal and chagasic nuclear fractions and then stimulated with collagen at threshold level (CT-PRP) an inhibition of the aggregatory response was observed. Treatment of CT-PRP with normal and chagasic mitochondrial fractions induced inhibition of platelet aggregation whereas only chagasic fraction reduced latency time. Microsornal fraction from normal placentas showed no significant effects on platelet aggregation. It is concluded that subcellular fractions of normal human syncytiotrophoblast do not exhibit any effect on platelet aggregation, whereas those subcellular fractions enriched in intracellular membrane components isolated from chagasic placentas inhibit platelet aggregation.

Prevalence of antinuclear autoantibodies in the serum of normal blood dornors

OBJECTIVE:To examine the presence of serum antinuclear autoantibodies in a healthy population. METHODS: Serum of 500 normal blood donors between 18 and 60 years of age were tested for the presence of autoantibodies. Antinuclear antibodies were detected by indirect immunofluorescence technique using HEp-2 epithelial cells as the substrate. The presence of dnaN was detected by indirect immunofluorescence technique using Critidia lucillae as the substrate. Anti-SSA (RO), anti-SSB (LA), anti-Sm, and anti-RNP were determined by double radial immunodiffusion. RESULTS: In the evaluation of the presence of serum antibodies, antinuclear antibodies were detected in 22.6% of the sera. The presence of other antibodies was not significant. The majority of the titers were 1:40. CONCLUSION: The presence of autoantibodies is not necessarily pathologic and has to be related to the age group, gender, and clinical condition of the patient.

Myocardial perfusion by contrast echocardiography. Establishment of normal pattern of intracoronary injection and safety in humans

OBJECTIVE: To establish the normal pattern and safety of echocardiographic contrast in patients with no significant obstruction of epicardial coronary arteries. METHODS: 67 patients with normal coronary arteries or obstructions < 50% were selected from 277 patients who underwent coronary angiography (CA). Mean age was 56 ± 11years and 36 were males. At the end CA, echocardiographic contrast was selectively injected into each coronary artery. The parasternal short axis of the left ventricle (LV) was divided into six segments: anterior (A), antero-lateral (AL), postero-lateral (PL), posterior (P), infero-septal (IS) and antero-septal (AS). Anterolateral (ALPM) and posteromedial papillary muscles (PMPM) were also considered. The pattern and intensity of the appearance of the myocardial contrast was visually analyzed. RESULTS: The right coronary artery (RCA) was dominant in 60 patients. Contrast appearance was sudden and simultaneous in the 3 muscle layers. All segments could be contrasted after the injection in both coronary arteries. 100% of the AS, A and AL segments, 97% of the PL and 98% of the ALPM were perfused by the left coronary artery (LCA). P and IS segments were perfused by the RCA in 85% and 82%, respectively, and by a dominant LCA in 71% of the cases. The PMPM was perfused by a dominant RCA in 77% and by a dominant LCA in 86%. There were no symptoms. CONCLUSION: Intracoronary injection of the sonicated solution is a safe procedure that allows for an excellent opacification of the myocardium and can potentially be used during routine CA.

Effects of female diet and age on offspring sex ratio of the solitary parasitoid Pachycrepoideus vindemmiae (Rondani) (Hymenoptera, Pteromalidae)

Effects of female diet and age on offspring sex ratio of the solitary parasitoid Pachycrepoideus vindemmiae (Rondani) (Hymenoptera, Pteromalidae). Theories predict that females of parasitoid wasps would adjust the offspring sex ratio to environmental conditions in the oviposition patch, but the diet and age of females would also affect the sex ratio adjustment. Our focus was to test the effects of female diet and age on offspring sex ratio of the solitary parasitoid wasp, Pachycrepoideus vindemmiae (Rondani, 1875). Our results showed that females fed with honey had significantly less female biased offspring sex ratio than those fed only with water. Offspring sex ratio (male percentage) decreased with female age or female longevity at the beginning of oviposition but increased at the end. There should be a sperm limitation in P. vindemmiae females at the end of oviposition, and a higher frequency of unfertilized eggs were laid then. Females also laid more unfertilized eggs at the beginning of oviposition, which would be necessary to insure the mating among offspring. Male offspring developed faster and emerged earlier, which would also reduce the risk of virginity in offspring with female-biased sex ratio.

Degree of multicollinearity and variables involved in linear dependence in additive-dominant models

The objective of this work was to assess the degree of multicollinearity and to identify the variables involved in linear dependence relations in additive-dominant models. Data of birth weight (n=141,567), yearling weight (n=58,124), and scrotal circumference (n=20,371) of Montana Tropical composite cattle were used. Diagnosis of multicollinearity was based on the variance inflation factor (VIF) and on the evaluation of the condition indexes and eigenvalues from the correlation matrix among explanatory variables. The first model studied (RM) included the fixed effect of dam age class at calving and the covariates associated to the direct and maternal additive and non-additive effects. The second model (R) included all the effects of the RM model except the maternal additive effects. Multicollinearity was detected in both models for all traits considered, with VIF values of 1.03 - 70.20 for RM and 1.03 - 60.70 for R. Collinearity increased with the increase of variables in the model and the decrease in the number of observations, and it was classified as weak, with condition index values between 10.00 and 26.77. In general, the variables associated with additive and non-additive effects were involved in multicollinearity, partially due to the natural connection between these covariables as fractions of the biological types in breed composition.

Cytoskeletal proteins in the follicular wall of normal andcystic ovaries of sows

The expression of cytoskeletal proteins was evaluated immunohistochemically in 36 normal ovaries sampled from 18 sows and 44 cystic ovaries sampled from of 22 sows, was evaluated. All sows had history of reproductive problems, such as infertility or subfertility. The immunohistochemically stained area (IHCSA) was quantified through image analysis to evaluate the expression of these proteins in the follicular wall of secondary, tertiary, and cystic follicles. Cytokeratins (CK) immunoreactivity was strong in the granulosa cell layer (GC) and mild in the theca interna (TI) and externa (TE) of the normal follicles. There was severe reduction of the reaction to CK in the GC in the cystic follicles, mainly in the luteinized cysts. The immunoreactivity for vimentin was higher in the GC from normal and cystic follicles in contrast with the other follicular structures. In the luteinized cysts, the IHCSA for vimentin was significantly higher in TI and in both observed cysts, the labeling was more accentuated in TE. Immunohistochemical detection of desmin and α-SMA was restricted to the TE, without differences between the normal and cystic follicles. The results of the current study show that the development of ovarian cysts in sows is associated to changes in the expression of the cytoskeletal proteins CK and vimentin.

Cell lineage relationship in the stomach of normal and genetically manipulated mice

The oxyntic mucosa of the mouse stomach is lined with a heterogeneous population of cells that form numerous short pits continuous with long tubular glands. Tritiated thymidine radioautography has made it possible to pinpoint the origin of all cell types and to follow the differentiation/migration of different cell lineages along the pit-gland unit. The proliferating multipotent stem cells functionally anchored in the upper glandular region, the isthmus, give rise to three main lineage precursors: 1) pre-pit cells, which migrate upward to the pit while differentiating into mucus-producing pit cells; 2) pre-neck cells, which migrate downward to the glandular neck while differentiating into mucus-producing neck cells that, by approaching the glandular base, gradually change their phenotype into pepsinogen- and intrinsic factor-producing zymogenic cells; 3) pre-parietal cells, which differentiate into acid-producing parietal cells in the isthmus and then undergo bipolar migration towards the pit and the glandular base. Thus, parietal cells are the only cells that complete their differentiation in the isthmus and then migrate to be scattered throughout the pit-gland unit. To determine whether parietal cells play a role in controlling decisions about cell fate within the pit-gland unit, the gastric epithelium has been examined in transgenic mice expressing the H,K-ATPase ß-subunit-1035 to +24/simian virus 40 large T antigen fusion gene. The blockade in parietal cell differentiation in these mice produces an amplification of lineage precursors, a marked depletion of zymogenic cells and an increase in pit cell census. Ablation of parietal cells in another transgenic mouse model expressing the H,K-ATPase ß-subunit-1035 to +24/diphtheria toxin fragment A fusion gene also produces amplification of lineage precursors, and similar effects on zymogenic and pit cell census. These findings strongly suggest that parietal cells produce regulatory signals that control the cellular differentiation program of both pit and zymogenic cell lineages, and would hopefully improve our ability to identify the cellular pathways leading to malignant transformation

Immunophenotype of normal and leukemic bone marrow B-precursors in a Brazilian population. A comparative analysis by quantitative fluorescence cytometry

The distinction between normal and leukemic bone marrow (BM) B-precursors is essential for the diagnosis and treatment monitoring of acute lymphoblastic leukemia (ALL). In order to evaluate the potential use of quantitative fluorescence cytometry (QFC) for this distinction, we studied 21 normal individuals and 40 patients with CD10+ ALL. We characterized the age-related changes of the CD10, CD19, TdT, CD34 and CD79a densities in normal and leukemic BM. Compared to normal adults, the B-precursors from normal children expressed significantly lower values of CD34-specific antibody binding capacity (SABC) (median value of 86.6 vs 160.2 arbitrary units (a.u.) in children and adults, respectively). No significant age-related difference was observed in the expression of the other markers in the normal BM, or in any of the markers in the leukemic BM. Based on the literature, we set the cut-off value for the normal CD10 expression at 45 x 10³ a.u. for both age groups. For the remaining markers we established the cut-off values based on the minimum-maximum values in the normal BM in each age group. The expression of CD10 was higher than the cut-off in 30 ALL cases and in 18 of them there was a concomitant aberrant expression of other markers. In 9 of the 10 CD10+ ALL with normal CD10 SABC values, the expression of at least one other marker was aberrant. In conclusion, the distinction between normal and leukemic cells by QFC was possible in 38/40 CD10+ ALL cases.

Influence of the test situation on pup retrieval behavior of normal and undernourished lactating rats

Undernutrition of dams and pups disrupts the retrieval efficiency of mothers. However, if the mothers are assessed in their home cages, they spend more time with their litters. In the present study the effect of test conditions on pup retrieval behavior of mothers receiving a 25% (well-nourished group) and 8% casein diet (undernourished group) was examined. In agreement with previous studies, undernourished mothers spent more time with their litters than well-nourished dams as lactation proceeded. Pup retrieval behavior varied with test conditions. In the first experiment, the maternal behavior of dams was assessed by the standard procedure (pups were separated from their mother and scattered over the floor of the home cage). The mother was then returned and the number of retrieved pups was recorded. From day 3 to 8, the retrieval efficiency of undernourished dams decreased, while the retrieval efficiency of well-nourished mothers did not vary. In the second experiment, mothers were subjected to a single retrieval test (on day 9 of lactation) using the procedure described for experiment 1. No difference between well-nourished and undernourished mothers was observed. In the third experiment, seven-day-old pups were separated from the mothers and returned individually to a clean home cage. Dietary treatment did not affect the retrieval efficiency. However, undernourished dams reconstructed the nest more slowly than did well-nourished dams. Taken together, these results suggest that pup retrieval behavior of the undernourished mother is not impaired by dietary restriction when the maternal environment is disturbed minimally.

Effect of chronic fish oil supplementation on renal function of normal and cachectic rats

In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effects of orange winemaking variables on antioxidant activity and bioactive compounds

AbstractAscorbic acid, carotenoids and polyphenols stand out among the orange juice natural antioxidants. The winemaking process affects their bioavailability and bioactivity. Antioxidant activities (AA) were estimated in different process conditions to asses those properties. The AA and their correlation with ascorbic acid, total phenolics and carotenoids content were calculated. The variables and levels analyzed were: pasteurized and natural must (PJ and NJ), pH 3.5 and 4.0 and fermentation temperatures at 10°C and 20°C. Statistically significant differences (α=0.05) were found among bioactive compounds concentrations. Antioxidant compounds concentration was higher in raw material than in orange wine. Juice pasteurization caused the major losses while subsequent vinification affects them to a lesser extent. Highest antioxidants retention was measured in wines from JN fermented at pH 3.5 and 10 °C (JN-3.5-10) followed by wines from JP and fermented at the same conditions (JP-3.5-10). AA determined by DPPH showed a positive and close correlation with FRAP, while ABTS showed a low correlation with former assays. Juice pasteurization process and fermentation temperature influenced bioactive compound reduction which correlates with the AA variation.

Cardiac Sympathetic Hyperactivity after Chemotherapy: Early Sign of Cardiotoxicity?

Background:Chemotherapy with anthracyclines and trastuzumab can cause cardiotoxicity. Alteration of cardiac adrenergic function assessed by metaiodobenzylguanidine labeled with iodine-123 (123I-mIBG) seems to precede the drop in left ventricular ejection fraction.Objective:To evaluate and to compare the presence of cardiovascular abnormalities among patients with breast cancer undergoing chemotherapy with anthracyclines and trastuzumab, and only with anthracycline.Methods:Patients with breast cancer were analyzed clinical, laboratory, electrocardiographic and echocardiographic and cardiac sympathetic activity. In scintigraphic images, the ratio of 123I-mIBG uptake between the heart and mediastinum, and the washout rate were calculated. The variables were compared between patients who received anthracyclines and trastuzumab (Group 1) and only anthracyclines (Group 2).Results:Twenty patients, with mean age 57 ± 14 years, were studied. The mean left ventricular ejection fraction by echocardiography was 67.8 ± 4.0%. Mean washout rate was 28.39 ± 9.23% and the ratio of 123I-mIBG uptake between the heart and mediastinum was 2.07 ± 0.28. Of the patients, 82% showed an increased in washout rate, and the ratio of 123I-mIBG uptake between the heart and mediastinum decreased in 25%. Concerning the groups, the mean washout rate of Group 1 was 32.68 ± 9.30% and of Group 2 was 24.56 ± 7.72% (p = 0,06). The ratio of 123I-mIBG uptake between the heart and mediastinum was normal in all patients in Group 2, however, the Group 1, showed 50% the ratio of 123I-mIBG uptake between the heart and mediastinum ≤ 1.8 (p = 0.02).Conclusion:In women with breast cancer undergoing chemotherapy, assessment of cardiac sympathetic activity with 123I-mIBG appears to be an early marker of cardiotoxicity. The combination of chemotherapy showed higher risk of cardiac adrenergic hyperactivity.

Specific insulin and proinsulin in normal glucose tolerant first-degree relatives of NIDDM patients

In order to identify early abnormalities in non-insulin-dependent diabetes mellitus (NIDDM) we determined insulin (using an assay that does not cross-react with proinsulin) and proinsulin concentrations. The proinsulin/insulin ratio was used as an indicator of abnormal ß-cell function. The ratio of the first 30-min increase in insulin to glucose concentrations following the oral glucose tolerance test (OGTT; I30-0/G30-0) was taken as an indicator of insulin secretion. Insulin resistance (R) was evaluated by the homeostasis model assessment (HOMA) method. True insulin and proinsulin were measured during a 75-g OGTT in 35 individuals: 20 with normal glucose tolerance (NGT) and without diabetes among their first-degree relatives (FDR) served as controls, and 15 with NGT who were FDR of patients with NIDDM. The FDR group presented higher insulin (414 pmol/l vs 195 pmol/l; P = 0.04) and proinsulin levels (19.6 pmol/l vs 12.3 pmol/l; P = 0.03) post-glucose load than the control group. When these groups were stratified according to BMI, the obese FDR (N = 8) showed higher fasting and post-glucose insulin levels than the obese NGT (N = 9) (fasting: 64.8 pmol/l vs 7.8 pmol/l; P = 0.04, and 60 min post-glucose: 480.6 pmol/l vs 192 pmol/l; P = 0.01). Also, values for HOMA (R) were higher in the obese FDR compared to obese NGT (2.53 vs 0.30; P = 0.075). These results show that FDR of NIDDM patients have true hyperinsulinemia (which is not a consequence of cross-reactivity with proinsulin) and hyperproinsulinemia and no dysfunction of a qualitative nature in ß-cells.

Postprandial symptoms in dysmotility-like functional dyspepsia are not related to disturbances of gastric myoelectrical activity

Gastric dysrhythmias, such as tachy- or bradygastria, have been reported in patients with functional dyspepsia (FD), but their role in symptom production is uncertain. It is also not known whether gastric dysrhythmias in these patients can be elicited by physiological gastric distension with a meal. We investigated the relationships between symptoms after ingestion of different volumes of water following a test meal and gastric dysrhythmias in FD patients. Fourteen patients with dysmotility-like FD and 13 healthy volunteers underwent paired electrogastrography (EGG) studies. Fasted subjects ingested 150 ml of yoghurt with either 150 ml (low volume) or 300 ml (high volume) water in random order. Fasting and fed EGGs with monitoring of symptoms were performed in both studies. Ten FD patients (71.4%) reported upper abdominal discomfort and bloating after the low volume meal, but only one (7.1%) presented an abnormal EGG (dominant frequency in the 2-4-cpm range: 58%). Following the high volume meal, 7 patients (50%) had symptoms, but none had EGG abnormalities. No significant differences were found between FD patients and controls for any of the EGG variables, in any test. In FD patients with postprandial symptoms, the percentage of the EGG dominant frequency in the normal range (median, 84.6%; range, 76.0-100.0%) was similar (P > 0.20) to that in those without symptoms (88.5%; 75.0-100.0%). We conclude that disturbances of gastric myoelectrical activity are unlikely to play a role in the origin of postprandial upper abdominal discomfort and bloating in dysmotility-like FD.