82 resultados para REPETITIVE DNA-SEQUENCES
em Scielo Saúde Pública - SP
Resumo:
Tandemly repeated DNA sequences are found in the genome of higher eukaryotes, and have also been demonstrated in Trypanosoma cruzi. Repeated DNA sequences are potentially useful for the diagnostic detection of T. cruzi (A. Gonzales et al., 1984, Proc. Natl. Acad. Sci. USA, 81: 3356-3360). We have isoleted two clones from a genomic library of T. cruzi (Y strain) that contain, in one clone a family of at least seven copies of a repetitive sequence of approximately 600 base pairs, and in the other an independent copy of the same sequence. One copy of the repetition (HSP) and the independent clone (HCR) were sequenced by the Sanger procedure (Fig.). This sequence hybridized to four strains of T. cruzi tested and did not hybridize to eleven species of trypanosotids from five different Genera, being a good candidate for diagnostic assays. GenBank accession numbers: HSP#m31919, HCR#31920.
Resumo:
CA88 is the first long nuclear repetitive DNA sequence identified in the blood fluke, Schistosoma mansoni. The assembled S. mansoni sequence, which contains the CA88 repeat, has 8,887 nucleotides and at least three repeat units of approximately 360 bp. In addition, CA88 also possesses an internal CA microsatellite, identified as SmBr18. Both PCR and BLAST analysis have been used to analyse and confirm the CA88 sequence in other S. mansoni sequences in the public database. PCR-acquired nuclear repetitive DNA sequence profiles from nine Schistosoma species were used to classify this organism into four genotypes. Included among the nine species analysed were five sequences of both African and Asian lineages that are known to infect humans. Within these genotypes, three of them refer to recognised species groups. A panel of four microsatellite loci, including SmBr18 and three previously published loci, has been used to characterise the nine Schistosoma species. Each species has been identified and classified based on its CA88 DNA fingerprint profile. Furthermore, microsatellite sequences and intra-specific variation have also been observed within the nine Schistosoma species sequences. Taken together, these results support the use of these markers in studying the population dynamics of Schistosoma isolates from endemic areas and also provide new methods for investigating the relationships between different populations of parasites. In addition, these data also indicate that Schistosoma magrebowiei is not a sister taxon to Schistosoma mattheei, prompting a new designation to a basal clade.
Resumo:
Extensive chromosome size polymorphism in Plasmodium berghei in vivo mitotic multiplication. Size differences between homologous chromosomes mainly involve rearrangements in the subtelomeric regions while internal chromosomal regions are more conserved. Size differences are almost exclusively due to differences in the copy number of a 2.3 kb subtelomeric repeat unit. Not only deletion of 2.3 kb repeats occurs, but addition of new copies of this repeat sometimes results in the formation of enlarged chromosomes. Even chromosomes which originally lack 2.3 kb repeats, can acquire these during mitotic multiplication. In one karyotype mutant, 2.3 kb repeats were inserted within one of the original telomeres of chromosome 4, creating an internal stretch oftelomeric repeats. Chromosome translocation can contribute to chromosome size polymorphism as well We found a karyotype mutant in which chromosome 7 with a size of about 1.4 Mb is translocated to chromosome 13/14 with a size of about 3 Mb, resulting in a rearranged chromosome, which was shown to contain a junction between internal DNA sequences of chromosome 13/14 and subtelomeric 2.3 kb repeats of chromosome 7. In this mutant a new chromosome of 1.4 Mb is present which consists of part of chromosome 13/14.
Resumo:
Cercarial shedding tests do not provide species identification of the shistosomes concerned and cannot detect prepatent schistosomal infections. We have demonstrated that both immunodetection by ELISA of schistosomal antigens in snail hemophlymph, and dot hybridization of snail extracts by DNA probe representing highly repeated sequences, proved suitable for detecting infected snails during prepatnecy as well as patency. A group-specific monoclonal antibody was found to be suitable for detecting Schistosoma mansoni infection in Biomphalaria sp., but not for positive identification of S. haematobium in Blulinus sp. Comparative evaluation of the diagnostic qualities, and technical aspects and cost of these tests, point to the superiority of the immunodetection approach for large scale detection of snails prepatently infected with S. mansoni. This approach is potentially useful for providing extended information on schistosome-snail epidemiology that may facilitate rapid evaluation of the danger of post-control reinfection, and help make decisions on the time and place of supplementary control measures. In this context the potential usefulness of the immunodetection or DNA probing approach for facilitating catalytic model representation of schistosome-snail epidemiology warrants further evaluation. Specific identification of S. haematobium in Bulinus by either of these approaches may be possible depending on the development of suitable antibodies or DNA probes.
Resumo:
Since 1984, Anopheles (Kerteszia) lepidotus has been considered a mosquito species that is involved in the transmission of malaria in Colombia, after having been incriminated as such with epidemiological evidence from a malaria outbreak in Cunday-Villarrica, Tolima. Subsequent morphological analyses of females captured in the same place and at the time of the outbreak showed that the species responsible for the transmission was not An. lepidotus, but rather Anopheles pholidotus. However, the associated morphological stages and DNA sequences of An. pholidotus from the foci of Cunday-Villarrica had not been analysed. Using samples that were caught recently from the outbreak region, the purpose of this study was to provide updated and additional information by analysing the morphology of female mosquitoes, the genitalia of male mosquitoes and fourth instar larvae of An. pholidotus, which was confirmed with DNA sequences of cytochrome oxidase I and rDNA internal transcribed spacer. A total of 1,596 adult females were collected in addition to 37 larval collections in bromeliads. Furthermore, 141 adult females, which were captured from the same area in the years 1981-1982, were analysed morphologically. Ninety-five DNA sequences were analysed for this study. Morphological and molecular analyses showed that the species present in this region corresponds to An. pholidotus. Given the absence of An. lepidotus, even in recent years, we consider that the species of mosquitoes that was previously incriminated as the malaria vector during the outbreak was indeed An. pholidotus, thus ending the controversy.
Resumo:
We report the molecular characterization of a novel reiterated family of transcribed oligo(A)-terminated, interspersed DNA elements in the genome of Trypanosoma cruzi. Steady-state level of transcripts of this sequence family appeared to be developmentally regulated, since only in the replicative forms the parasite showed expression of related sequences with a major band around 3 kb. The presence of frame shifts or premature stop codons predicts that transcripts are not translated. The sequence family also contains truncated forms of retrotransposons elements that may become potential hot spots for retroelement insertion. Sequences homologous to this family are interspersed at many chromosomes including the subtelomeric regions.
Resumo:
The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp) sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
We have isolated a clone of Trypanosoma cruzi genimic DNA, lambda 3b2-5, which contains sequences that are reiterated in the genome. Northtern blot analysis showed that clone 3b2-5 hybridizes to 1,200-5,000 bases different mRNA species. The number of mRNAs species hybridized to clone 3b2-5 exceeds its coding capacity showing that this clone carries sequences that are common to several mRNAs species and conserved in the poly A(+) RNA. These sequences are not homologous to the T. cruzi spliced leader sequence, since clone 3b2-5 hybridize to a synthetic 20 nucleotice complementary to the spliced leader sequence. Clone 3b2-5 does not hybridize to DNA and RNA from several genera of Trypanosomatidae and other Trypanosoma species indicating that it carries T. cruzi species-specific sequences.
Resumo:
Genomic DNA fragments from males of Psychodopygus wellcomei were isolated and shown to be useful as sensitive diagnostic probles for positively separting individuals of this species from those of Ps. complexus. These two members of the Ps. squamiventris series are found sympatrically in foci of cutaneous leishmaniasis in the hill forests of southern Pará State. Of the two species, only Ps. welcomei is thought to be an important vector of Leishmania braziliensis sensu stricto, buth this is based on circumstantial evidence because of the difficulties of identifying female sandflies wothin the series. The diagnostic probes were isolated from a library of Ps. wellcomei built by ligationg short fragments of Sau 3A-resistricted, genomic DNA into the plasmid vector PUC 18. Differential screening of 1316 library clones with total genomic DNA of Ps. Wellcomei and Ps. complexus identified 5 recombinants, with cross-hybridizing inserts of repetitive DNA, that showed strong specificity for Ps. wellcomei. As little as 0.4% of the DNA extracted from an individual sandfly (=ca. 0.5 namograms) was specifically detected. The diagnostic probes were used to identify as Ps. wellcomei a wild-caught female sandfly found infected with L. braziliensis s.s., providing only the second positive association between these two species.
Resumo:
The development of a repetitive DNA probe for Babesia bigemina was reviewed. The original plasmid (p(Bbi)16) contained an insert of B. bigemina DNA of approximately 6.3 kb. This probe has been evaluated for specificityand analytical sensitivity by dot hybridization with isolates from Mexico, the Caribbean region and Kenya. A partial restriction map has been constructed and insert fragments have been subcloned and utilized as specific DNA probes. A comparison of 32P labelled and non-radioactive DNA probes was presented. Non-radioctive detection systems that have been used include digoxigenin dUTP incorporation, and detection by colorimetric substrate methods. Derivatives from the original DNA probe have been utilized to detect B. bigemina infection in a) experimentally inoculated cattle, b) field exposed cattle, c) infected Boophilus microplus ticks, and d) the development of a PCR amplification system.
Resumo:
A hundred-sixty paraffin-embedded specimens from female cervical lesions were examined for human papillomavirus (HPV) types 6, 11, 16 and 18 infections by non-isotopic in situ hybridization. The data were compared with histologic diagnosis. Eighty-eight (55) biopsies contained HPV DNA sequences. In low grade cervical intraepithelial neoplasias (CIN I), HPV infection was detected in 78.7 of the cases, the benign HPV 6 was the most prevalent type. HPV DNA was detected in 58 of CIN II and CIN III cases and in 41.8 of squamous cell carcinomas (SCC). Histologically normal women presented 20 of HPV infection. Oncogenic HPV was found in 10 of these cases, what may indicate a higher risk of developing CINs and cancer. Twenty-five percent of the infected tissues contained mixed infections. HPV 16 was the most common type infecting the cervix and its prevalence raised significantly with the severity of the lesions, pointing its role in cancer pathogenesis. White women presented twice the cervical lesions of mulatto and African origin women, although HPV infection rates were nearly the same for the three groups (approximately 50). Our results showed that HPV typing by in situ hybridization is a useful tool for distinguishing between low and high risk cervical lesions. Further studies are required to elucidate risk factors associated with HPV infection and progression to malignancy in Brazilian population.
Resumo:
Among the molecular markers commonly used for mosquito taxonomy, the internal transcribed spacer 2 (ITS2) of the ribosomal DNA is useful for distinguishing among closely-related species. Here we review 178 GenBank accession numbers matching ITS2 sequences of Latin American anophelines. Among those, we found 105 unique sequences corresponding to 35 species. Overall the ITS2 sequences distinguish anopheline species, however, information on intraspecific and geographic variations is scarce. Intraspecific variations ranged from 0.2% to 19% and our analysis indicates that misidentification and/or sequencing errors could be responsible for some of the high values of divergence. Research in Latin American malaria vector taxonomy profited from molecular data provided by single or few field capture mosquitoes. However we propose that caution should be taken and minimum requirements considered in the design of additional studies. Future studies in this field should consider that: (1) voucher specimens, assigned to the DNA sequences, need to be deposited in collections, (2) intraspecific variations should be thoroughly evaluated, (3) ITS2 and other molecular markers, considered as a group, will provide more reliable information, (4) biological data about vector populations are missing and should be prioritized, (5) the molecular markers are most powerful when coupled with traditional taxonomic tools.
Resumo:
Members of the Herpesviridae family have been implicated in a number of tumours in humans. At least 75% of the human population has had contact with cytomegalovirus (HCMV). In this work, we screened 75 Brazilian glioma biopsies for the presence of HCMV DNA sequences. HCMV DNA was detected in 36% (27/75) of the biopsies. It is possible that HCMV could be a co-factor in the evolution of brain tumours.