229 resultados para Progeny test

em Scielo Saúde Pública - SP


Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foi aplicada uma versão reduzida do "Face-Hand Test", o FHT-R, em 91 pessoas com 65 anos ou mais em uma amostra ao acaso de idosos vivendo na comunidade (São Paulo, Brasil), com objetivo de testar a habilidade do instrumento em detectar as síndromes psicorgânicas. Os escores do FHT-R foram comparados com as avaliações de um psiquiatra utilizando uma entrevista semi-estruturada, a "Clinical Interview Schedule". Cinco pessoas foram consideradas como sendo portadoras de distúrbios psicorgânicos e 86 como não sendo portadoras de tais distúrbios. No ponto de corte 0/1 os coeficientes de validação obtidos foram: sensibilidade 60%, especificidade 94%, valor prognóstico positivo 38%, valor prognóstico negativo 98%, e taxa de classificação incorreta 8%. A utilização do Teste em pesquisas epidemiológicas é discutida no corpo do trabalho.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The study was carried out to evaluate the diagnostic performance of the ICT malaria Pf/PvTM test for vivax malaria diagnosis in Belém, Amazon region, Brazil. The results of blood malaria parasites examination using an immunochromatography test were compared with thick blood film (TBF) examination. It was also evaluated the performance of this test storaged at three different temperatures (25°C, 30°C, and 37°C) for 24 hours before use. Overall sensitivity of ICT Pf/PvTM was 61.8% with a specificity of 100%, positive and negative predictive value of 100% and 71.8%, respectively and accuracy of 80.6%. The test sensitivity was independent of the parasite density. This test needs to be further reviewed in order to have better performance for P. vivax malaria diagnosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To analyze the scoring obtained by an instrument, which evaluates the ability to read and understand items in the health care setting, according to education and age. METHODS: The short version of the Test of Functional Health Literacy in Adults was administered to 312 healthy participants of different ages and years of schooling. The study was conducted between 2006 and 2007, in the city of São Paulo, Southeastern Brazil. The test includes actual materials such as pill bottles and appointment slips and measures reading comprehension, assessing the ability to read and correctly pronounce a list of words and understand both prose passages and numerical information. Pearson partial correlations and a multiple regression model were used to verify the association between its scores and education and age. RESULTS: The mean age of the sample was 47.3 years(sd=16.8) and the mean education was 9.7 years(sd=5; range: 1 - 17). A total of 32.4% of the sample showed literacy/numeracy deficits, scoring in the inadequate and marginal functional health literacy ranges. Among the elderly (65 years or older) this rate increased to 51.6%. There was a positive correlation between schooling and scores (r=0.74; p<0.01) and a negative correlation between age and the scores (r=-0.259; p<0.01). The correlation between the scores and age was not significant when the effects of education were held constant (rp=-0.031, p=0.584). A significant association (B=3.877, Beta =0.733; p<0.001) was found between schooling and scores. Age was not a significant predictor in this model (B=-0.035, Beta=-0.22; p=0.584). CONCLUSIONS: The short version of the Test of Functional Health Literacy in Adults was a suitable tool to assess health literacy in the study population. The high number of individuals classified as functional illiterates in this test highlights the importance of special assistance to help them properly understand directions for healthcare.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To assess individual and/or health service factors associated with patients returning for results of HIV or sexually transmitted infection (STI) tests in mental health centers. METHODS: Cross-sectional national multicenter study among 2,080 patients randomly selected from 26 Brazilian mental health centers in 2007. Multilevel logistic regression was used to assess the effect of individual (level 1) and mental health service characteristics (level 2) on receipt of test results. RESULTS: The rate of returning HIV/STI test results was 79.6%. Among health service characteristics examined, only condom distribution was associated with receiving HIV/STI test results, whereas several individual characteristics were independently associated including living in the same city where treatment centers are; being single; not having heard of AIDS; and not having been previously HIV tested. CONCLUSIONS: It is urgent to expand HIV/STI testing in health services which provide care for patients with potentially increased vulnerability to these conditions, and to promote better integration between mental health and health services.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

ABSTRACT OBJECTIVE To validate a Spanish version of the Test of Gross Motor Development (TGMD-2) for the Chilean population. METHODS Descriptive, transversal, non-experimental validity and reliability study. Four translators, three experts and 92 Chilean children, from five to 10 years, students from a primary school in Santiago, Chile, have participated. The Committee of Experts has carried out translation, back-translation and revision processes to determine the translinguistic equivalence and content validity of the test, using the content validity index in 2013. In addition, a pilot implementation was achieved to determine test reliability in Spanish, by using the intraclass correlation coefficient and Bland-Altman method. We evaluated whether the results presented significant differences by replacing the bat with a racket, using T-test. RESULTS We obtained a content validity index higher than 0.80 for language clarity and relevance of the TGMD-2 for children. There were significant differences in the object control subtest when comparing the results with bat and racket. The intraclass correlation coefficient for reliability inter-rater, intra-rater and test-retest reliability was greater than 0.80 in all cases. CONCLUSIONS The TGMD-2 has appropriate content validity to be applied in the Chilean population. The reliability of this test is within the appropriate parameters and its use could be recommended in this population after the establishment of normative data, setting a further precedent for the validation in other Latin American countries.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Twenty patients with prolonged septicemic salmonellosis (Group 1) and 20 with schistosomiasis mansoni (Group 2) were selected for this study. In both groups, the Widal test was done using antigens of the sample Ty 901 (S. typhi). The test was also applied in 6 group 1 patients with antigens prepared from salmonellae isolated from these patients (autoantigens). Titres over 1:200 were considered significant. Ten group 1 patients (50%) were positive for antigen "H" and 5 (25%) were positive for antigen "O". Three patients with negative "H" and "O" reactions became positive with high titres when using autoantigens. Two other cases maintained the same positive titres and one case showed a fourfold increase in titres when the test was done 'with antigens of the Salmonella isolated. The Widal test was positive in most patients infected with group D Salmonellae. Considering titres above 1:200, all cases were negative in Group 2. The authors conclude that the Widal test has low positivity in prolonged septicemic salmonellosis. The test may be valuable in the diagnosis of this disease when using S. paratyphi "A" and "B" antigens and a mixture of Salmonella antigens taken from other groups.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The susceptibility of the MAP Brazilian strain (F1 to F5 progenies) of S. mansoni to four antischistosomal drugs has been reported in a previous study. In the present investigation, progeny F14 of the same strain, was tested for stability to the same 4 drugs. A new medication, Oltipraz (35,972 RP), was added to the study. Five groups of 12 mice infected with cercariae by tail immersion were treated with hycanthone, oxamniquine, niridazole, praziquantel and Oltipraz. An untreated group was used as control. Schistosomal activity was assessed by the localization of worms in the portal vein system, by oogram changes, and percentage of parasite reduction. The stability of the susceptibility of progeny F14 did not change in relation to generations F1 to F5; the progeny was resistant to hycanthone and oxamniquine; but sensitive to niridazole, praziquantel and Oltipraz. We emphasize the importance of the phenomenon of resistance of the worm in view of the fact that oxamniquine has been widely used in Brazilian areas where mansonic schistosomiasis is endemic.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lectins were labeled with fluorescein and tried as conjugates in the immunofluorescence (IP) test for the detection of IgM antibodies to T. gondii, in the diagnosis of acute toxoplasmosis. This approach was an attempt to find alternative reagents for anti-human IgM fluorescent conjugates (AHIgMFC), which contain quite frequently anaibcdies to toxoplasma, as contaminants, due to natural T. gondii infections among animals used for imunization. Lentil (Lens culinaris) lectin fluorescence conjugates (LcFC) provided most satisfactory results. The evaluation of LcFC carried out in a total of 179 sera from patients with acute and chronic toxoplasmosis, with non-related infections or healthy subjects, gave high values of relative efficiency, co-positivity and co-negativity indices, respectively 0.989, 0.969 and 1.000, in reference to the conventional AHIgMFC. Moreover, three batches of LcFC successively prepared gave reproducible test results. The advantage of LcFC as an alternative reagent for the serodiagnosis of acute toxoplasmosis is supported by practical aspects of its preparation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A passive haemagglutination test (PHA) for human neurocysticercosis was standardized and evaluated for the detection of specific antibodies to Cysticercus cellulosae in cerebrospinal fluid (CSF). For the assay, formaldehyde-treated group O Rh-human red cells coated with the cysticerci crude total saline extract (TS) antigen were employed. A total of 115 CSF samples from patients with neurocysticercosis was analysed, of these 94 presented reactivity, corresponding to 81.7% sensitivity, in which confidence limit of 95% probability (CL95%) ranged from 74.5% to 88.9%. Eighty-nine CSF samples derived from individuals of control group presented as nonreactive in 94.4% (CL95% from 89.6% to 99.2%). The positive and negative predictive values were 1.4% and 99.9%, respectively, considering the mean rate of that this assay provide a rapid, highly reproducible, and moderately sensitive mean of detecting specific antibodies in CSF samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A comparison of two different standardized reagent procedures for the passive haemagglutination test (PHA) in the detection of specific antibody to Cysticercus cellulosae in cerebrospinal fluid (CSF) was carried out. The formaldehyde-treated group O Rh-human red blood cells (HuRBC) and glutaraldehyde-treated sheep red blood cells (SRBC) were the supplies for the reagents preparation and, in the tests, they were designated as PHA-1 and PHA-2, respectively. For both reagents the cells were coated with the cysticerci total saline extract (TS) antigen. PHA-1 and PHA-2 were assessed in a total of 204 CSF from patients with neurocysticercosis, from non-related infections and from healthy individuals. The positivity and specificity indices obtained were respectively 81.7% and 94.4% for PHA-1 and for PHA-2, 88.7% and 96.6%. Since no significant differences were observed between the results provided by two reagents, at level of significance of 0.05, either processes of cell sensitization can alternatively be used according to the own laboratory convenience.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Performance indexes of the peroxidase antibody test were compared to that of the fluorescent antibody test. The peroxidase antibody test had a statistically higher sensitivity and negative predictive value and a higher efficiency than the fluorescent antibody test but its specificity and positive predictive value were within the 95% confidence limits for the values found for the fluorescent antibody test. Such differences did not change when Chagas' disease and visceral leishmaniasis sera were included in index calculations. Statistical analysis showed that the two tests have a substantial degree of agreement but the immunofluorescent test had a specificity index and a positive predictive value equal to 100.0% when Chagas' disease and visceral leishmaniasis sera were not included in the calculations of the performance index; in this instance, a positive test result equals a disclosure of the disease attribute due to the inexistence of false positive results. The enzyme/ protein ratio of the peroxidase conjugate, resulting in heavy or light-labeled conjugates may pose technical problems to its use in serology tests.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We used the micro- and macroimmunodiffusion test for the qualitative and quantitative measurement of anti - P. brasiliensis antibodies in serum of patients with paracoccidioidomycosis. All 103 paracoccidioidomycosis sera (100%) were positive in the micro test versus 87% positivity index in the macrotest. All 83 control sera from patients with other diseases were negative in both tests. Titers of the positive sera tended to be higher in the microtest, which revealed sharper and easier to read precipiting bands. Microimmunodiffusion is simple to be performed, requires a minimum amount of reagents and allows the simultaneous testing of 102 sera. It may replace the macrotest specially in laboratories dealing with great serologic routine.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the present work the immune adherence hemagglutination test (IAHA) was standardized in a simplified procedure. This test showed good reproducibility, better than the classical mice serum neutralization test (SN). The tests showed high correlation degree: high titers in one test corresponded to high titers in the other one, and the same occured with low titers. The IAHA test is extremely simple, fast to perform, and of low cost when compared to tests such as SN or indirect immunofluorescense (IIF). It also proved to be useful in less sophisticated laboratories or even as a screening test for the titration of rabies antibodies.