Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica

Differences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting (RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individual characterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, were employed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction of symptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains. The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a high degree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved in the pathogenesis of amebiasis.

IS6110 fingerprinting of sensitive and resistant strains (1991-1992) of Mycobacterium tuberculosis in Colombia

The standardized method to study the polymorphism of IS 6110 was used to characterize 53 isolates of Mycobacterium tuberculosis obtained during 1991-1992 from 14 regions in Colombia. In Valle region cluster rate was 25% (4/16). The mean number of IS6110 band was 10 ± 3. Similarity between strains was of 60% in 81% of strains and this tended to be correlated with geographic origin. For the first time M. tuberculosis without IS6110 bands in restriction fragment length polymorphism analysis was found in Colombia. Additional studies are necessaries in order to best characterize the situation in relation to human immunodeficiency virus epidemic and recent changes in tuberculosis control program.

Genetic relationships between sympatric populations of Bacillus cereus and Bacillus thuringiensis, as revealed by rep-PCR genomic fingerprinting

The bacterial strain Bacillus cereus is closely related to Bacillus thuringiensis, although any genetic relationship between the two strains is still in debate. Using rep-PCR genomic fingerprinting, we established the genetic relationships between Brazilian sympatric populations of B. cereus and B. thuringiensis simultaneously collected from two geographically separate sites. We observed the formation of both B. thuringiensis and B. cereus clusters, as well as strains of B. cereus that are more closely related to B. thuringiensis than to other B. cereus strains. In addition, lower genetic variability was observed among B. thuringiensis clusters compared to B. cereus clusters, indicating that either the two species should be categorized as separate or that B. thuringiensis may represent a clone from a B. cereus background.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Classification and fingerprinting of different berries based on biochemical profiling and antioxidant capacity

The objective of this work was to evaluate the biochemical composition of six berry types belonging to Fragaria, Rubus, Vaccinium and Ribes genus. Fruit samples were collected in triplicate (50 fruit each) from 18 different species or cultivars of the mentioned genera, during three years (2008 to 2010). Content of individual sugars, organic acids, flavonols, and phenolic acids were determined by high performance liquid chromatography (HPLC) analysis, while total phenolics (TPC) and total antioxidant capacity (TAC), by using spectrophotometry. Principal component analysis (PCA) and hierarchical cluster analysis (CA) were performed to evaluate the differences in fruit biochemical profile. The highest contents of bioactive components were found in Ribes nigrum and in Fragaria vesca, Rubus plicatus, and Vaccinium myrtillus. PCA and CA were able to partially discriminate between berries on the basis of their biochemical composition. Individual and total sugars, myricetin, ellagic acid, TPC and TAC showed the highest impact on biochemical composition of the berry fruits. CA separated blackberry, raspberry, and blueberry as isolate groups, while classification of strawberry, black and red currant in a specific group has not occurred. There is a large variability both between and within the different types of berries. Metabolite fingerprinting of the evaluated berries showed unique biochemical profiles and specific combination of bioactive compound contents.

Molecular characterization of Brazilian strains of Xanthomonas campestris pv. viticola by rep-PCR fingerprinting

Bacterial canker of grapevine (Vitis vinifera), caused by Xanthomonas campestris pv. viticola was first detected in Brazil in 1998, affecting grapevines in the São Francisco river basin, state of Pernambuco. The disease was also reported in Juazeiro, Bahia and later in Piauí and Ceará. Due to its limited geographical distribution and relatively recent detection in Brazil, very little is known about the pathogen's biology and diversity. Repetitive DNA based-PCR (rep-PCR) profiles were generated from purified bacterial DNA of 40 field strains of X. campestris pv. viticola, collected between 1998 and 2001 in the states of Pernambuco, Bahia and Piauí. Combined analysis of the PCR patterns obtained with primers REP, ERIC and BOX, showed a high degree of similarity among Brazilian strains and the Indian type strain NCPPB 2475. Similar genomic patterns with several diagnostic bands, present in all strains, could be detected. Fingerprints were distinct from those of strains representing other pathovars and from a yellow non-pathogenic isolate from grape leaves. The polymorphism observed among the Brazilian strains allowed their separation into five subgroups, although with no correlation with cultivar of origin, geographic location or year collected.

Synecological comparisons sustained by ecophysiological fingerprinting of intrinsic photosynthetic capacity of plants as assessed by measurements of light response curves

In some literature variations in photosynthetic rates are considered to be of little relevance for individual fitness. This depends among other things on how one defines fitness, i.e. if one takes strictly Darwinian fitness as seed production or if one needs to evaluate particular traits and consider plant establishment. It also matters if one takes the Darwinian "organism individual" as the central entity in evolution ("individual fitness") or the "species individual" in a modified "Structure of Evolutionary Theory" sensu Stephen Jay Gould. A phenotypically expressed trait like photosynthetic rate, even if intra- and interspecific differences may be small, can matter in habitat performance and niche acquisition. Light dependence curves (LCs) of photosynthetic rates are now readily measured under field conditions using miniaturized equipment of pulse amplitude modulated fluorometers. In contrast to actual momentary measurements of quantum yield of photosynthesis under actually prevailing ambient conditions, LC measurements reflect the expressed intrinsic capacity of photosynthesis. In this review we explore the power of LC measurements yielding cardinal points such as maximum apparent electron transport rate of photosystem II (ETRmax) and saturating photosynthetically active radiation (PARsat) in making intra- and interspecific comparisons of plant performance and synecological fingerprinting in ecophysiological studies across species, sites, habitats and ecosystems.

DNA fingerprinting of Mycobacterium tuberculosis from patients with and without AIDS in Rio de Janeiro

Isolates of Mycobacterium tuberculosis derived from patients with AIDS from a single hospital in Rio de Janeiro were typed using a standardized RFLP technique detecting IS6110 polymorphism. Nineteen isolates were obtained from 15 different patients. Eleven distinct IS6110 patterns were found, with 4 banding patterns shared by 2 patients. The clustering value of 53% was much higher in comparison with clustering of M. tuberculosis strains from TB patients without clinical signs for HIV infection from randomly selected health centers. We present these results as preliminary data on M. tuberculosis strain polymorphism in Brazil and on the higher risk for recent transmission amongst patients with AIDS

Fingerprinting of cell lines by directed amplification of minisatellite-region DNA (DAMD)

The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA), developed by Heath et al. [Nucleic Acids Research (1993) 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel) specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.

Electrophoretic protein patterns and numerical analysis of Candida albicans from the oral cavities of healthy children

The aim of this research was to evaluate the protein polymorphism degree among seventy-five C. albicans strains from healthy children oral cavities of five socioeconomic categories from eight schools (private and public) in Piracicaba city, São Paulo State, in order to identify C. albicans subspecies and their similarities in infantile population groups and to establish their possible dissemination route. Cell cultures were grown in YEPD medium, collected by centrifugation, and washed with cold saline solution. The whole-cell proteins were extracted by cell disruption, using glass beads and submitted to SDS-PAGE technique. After electrophoresis, the protein bands were stained with Coomassie-blue and analyzed by statistics package NTSYS-pc version 1.70 software. Similarity matrix and dendrogram were generated by using the Dice similarity coefficient and UPGMA algorithm, respectively, which made it possible to evaluate the similarity or intra-specific polymorphism degrees, based on whole-cell protein fingerprinting of C. albicans oral isolates. A total of 13 major phenons (clusters) were analyzed, according to their homogeneous (socioeconomic category and/or same school) and heterogeneous (distinct socioeconomic categories and/or schools) characteristics. Regarding to the social epidemiological aspect, the cluster composition showed higher similarities (0.788 < S D < 1.0) among C. albicans strains isolated from healthy children independent of their socioeconomic bases (high, medium, or low). Isolates of high similarity were not found in oral cavities from healthy children of social stratum A and D, B and D, or C and E. This may be explained by an absence of a dissemination route among these children. Geographically, some healthy children among identical and different schools (private and public) also are carriers of similar strains but such similarity was not found among other isolates from children from certain schools. These data may reflect a restricted dissemination route of these microorganisms in some groups of healthy scholars, which may be dependent of either socioeconomic categories or geographic site of each child. In contrast to the higher similarity, the lower similarity or higher polymorphism degree (0.499 < S D < 0.788) of protein profiles was shown in 23 (30.6%) C. albicans oral isolates. Considering the social epidemiological aspect, 42.1%, 41.7%, 26.6%, 23.5%, and 16.7% were isolates from children concerning to socioeconomic categories A, D, C, B, and E, respectively, and geographically, 63.6%, 50%, 33.3%, 33.3%, 30%, 25%, and 14.3% were isolates from children from schools LAE (Liceu Colégio Albert Einstein), MA (E.E.P.S.G. "Prof. Elias de Melo Ayres"), CS (E.E.P.G. "Prof. Carlos Sodero"), AV (Alphaville), HF (E.E.P.S.G. "Honorato Faustino), FMC (E.E.P.G. "Prof. Francisco Mariano da Costa"), and MEP (E.E.P.S.G. "Prof. Manasses Ephraim Pereira), respectively. Such results suggest a higher protein polymorphism degree among some strains isolated from healthy children independent of their socioeconomic strata or geographic sites. Complementary studies, involving healthy students and their families, teachers, servants, hygiene and nutritional habits must be done in order to establish the sources of such colonization patterns in population groups of healthy children. The whole-cell protein profile obtained by SDS-PAGE associated with computer-assisted numerical analysis may provide additional criteria for the taxonomic and epidemiological studies of C. albicans.

Optimization of random amplified polymorphic DNA techniques for use in genetic studies of Cuban triatominae

Random amplified polymorphic DNA (RAPD) technique is a simple and reliable method to detect DNA polymorphism. Several factors can affect the amplification profiles, thereby causing false bands and non-reproducibility of assay. In this study, we analyzed the effect of changing the concentration of primer, magnesium chloride, template DNA and Taq DNA polymerase with the objective of determining their optimum concentration for the standardization of RAPD technique for genetic studies of Cuban Triatominae. Reproducible amplification patterns were obtained using 5 pmoL of primer, 2.5 mM of MgCl2, 25 ng of template DNA and 2 U of Taq DNA polymerase in 25 µL of the reaction. A panel of five random primers was used to evaluate the genetic variability of T. flavida. Three of these (OPA-1, OPA-2 and OPA-4) generated reproducible and distinguishable fingerprinting patterns of Triatominae. Numerical analysis of 52 RAPD amplified bands generated for all five primers was carried out with unweighted pair group method analysis (UPGMA). Jaccard's Similarity Coefficient data were used to construct a dendrogram. Two groups could be distinguished by RAPD data and these groups coincided with geographic origin, i.e. the populations captured in areas from east and west of Guanahacabibes, Pinar del Río. T. flavida present low interpopulation variability that could result in greater susceptibility to pesticides in control programs. The RAPD protocol and the selected primers are useful for molecular characterization of Cuban Triatominae.

Genotyping, serotyping and determination of mating-type of Cryptococcus neoformans clinical isolates from São Paulo State, Brazil

The basidiomycetous yeast Cryptococcus neoformans is an important fungal pathogen mainly in immunocompromised patients. In this study, 47 clinical isolates of C. neoformans from regions of São Paulo State were studied serologically by using the Crypto Check Iatron RM 304-K kit, their genetic diversity was estimated by PCR-fingerprinting with a microsatellite-specific sequence (GACA)4, RAPD with primer 6 (Amersham Pharmacia Biotech), PCR-restriction fragment length polymorphism (RFLP) analysis of the phospholipase B gene (PLB1) digested with AvaI and mating type analysis by PCR. All 47 strains isolated from HIV positive patients included in this study were serotype A and MATalpha. The majority of the isolates (45/47) were VNI and only two were VNII by PCR-fingerprinting and PCR-RFLP analysis. High degree of homogeneity was observed when (GACA)4 was used, being highly correlated (> 0.9). In contrast, the RAPD analysis was more heterogeneous with higher number of molecular profiles. By PCR-RFLP, no new molecular type was found, enhancing the suggestion that the differences based on conserved gene as PLB1, can be resultant of ongoing divergent evolution within the C. neoformans complex, into the current eight subtypes. Our results furnish new information on the molecular epidemiology of C. neoformans in the southeast region of Brazil.

Optimization of randomly amplified polymorphic DNA-polymerase chain reaction for molecular typing of Salmonella enterica serovar Typhi

Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.

Clinical and microbiological features of cryptococcal meningitis

Introduction In this study, the clinical features, underlying diseases and clinical outcomes of patients with cryptococcosis were investigated. In addition, a molecular analysis of the Cryptococcus neoformans species complex isolated from these patients was performed. Methods A prospective study of 62 cases of patients with cryptococcal infection was conducted at the Hospital de Doenças Tropicais de Goiás Dr. Anuar Auad from 2009-2010. Cryptococcal meningitis cases were diagnosed by direct examination and cerebrospinal fluid (CSF) sample culture. The profiling of these patients was assessed. The CSF samples were submitted to India ink preparation and cultured on Sabouraud dextrose agar, and C. neoformans was identified by the production of urease, a positive phenoloxidase test and assimilation of carbohydrates. C. neoformans and C. gattii isolates were distinguished by growth on L-canavanine-glycine-bromothymol blue medium, and molecular analysis was conducted via PCR fingerprinting reactions using M13 and (GACA)4 primers. Results From the 62 patients with cryptococcosis, 71 isolates of CSF were obtained; 67 (94.4%) isolates were identified as C. neoformans var. grubii/VNI, and 4 (5.6%) were identified as C. gattii/VGII. Of these patients, 53 had an HIV diagnosis. The incidence of cryptococcosis was higher among patients 20-40 years of age, with 74.2% of the cases reported in males. Cryptococcus-related mortality was noted in 48.4% of the patients, and the symptoms were altered sensorium, headache, fever and stiff neck. Conclusions The high morbidity and mortality observed among patients with cryptococcosis demonstrate the importance of obtaining information regarding the epidemiological profile and clinical course of the disease in the State of Goiás, Brazil.