78 resultados para NORMAL HUMAN FIBROBLASTS

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The multidrug resistance P-glycoprotein is a transmembrane efflux pump expressed by lymphocytes and is involved in their cytolytic activity. In the present study, we investigated the age-related changes of P-glycoprotein function in normal peripheral blood lymphocytes. Blood samples from 90 normal volunteers (age range, 0 to 86 years) were analyzed. P-glycoprotein function was assessed by the flow cytometric rhodamine 123 assay. P-glycoprotein function was highest in cord blood and progressively declined with age in peripheral blood T CD4+ and CD8+ cells. In contrast, P-glycoprotein function did not vary with age in CD19+ B or CD16+CD56+ natural killer cells. These data suggest that the decline in P-glycoprotein function in T CD4+ and CD8+ lymphocytes as a function of age may contribute to the decrease in T cell cytolytic activity with aging.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The surface of human syncytiotrophoblast does not induce maternal blood platelet aggregation even though it is not an endothelium. It can be surmised that as occurs in endothelial injury the subcellular components of the syncytiotrophoblast may have pro-or antiaggregatory activity. During congenital Chagas' disease which is associated to trophoblast lesions, platelets may play a role in the development of T. cruzi-induced placentitis. In the present work the aggregatory behaviour of normal human blood platelets was recorded after their challenging with subcellular fractions of syncytiotrophoblast isolated from normal and chagasic women. Nuclear, Mitochondrial, Microsomal and Supernatant fractions isolated from normal and chagasic syncytiotrophoblast failed to induce per se any aggregatory reaction on platelets. When samples of platelet-rich plasma (PRP) were preincubated with normal and chagasic nuclear fractions and then stimulated with collagen at threshold level (CT-PRP) an inhibition of the aggregatory response was observed. Treatment of CT-PRP with normal and chagasic mitochondrial fractions induced inhibition of platelet aggregation whereas only chagasic fraction reduced latency time. Microsornal fraction from normal placentas showed no significant effects on platelet aggregation. It is concluded that subcellular fractions of normal human syncytiotrophoblast do not exhibit any effect on platelet aggregation, whereas those subcellular fractions enriched in intracellular membrane components isolated from chagasic placentas inhibit platelet aggregation.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Trichomonas vaginalis and Tritrichomonas foetus are parasitic, flagellated protists that inhabit the urogenital tract of humans and bovines, respectively. T. vaginalis causes the most prevalent non-viral sexually transmitted disease worldwide and has been associated with an increased risk for human immunodeficiency virus-1 infection in humans. Infections by T. foetus cause significant losses to the beef industry worldwide due to infertility and spontaneous abortion in cows. Several studies have shown a close association between trichomonads and the epithelium of the urogenital tract. However, little is known concerning the interaction of trichomonads with cells from deeper tissues, such as fibroblasts and muscle cells. Published parasite-host cell interaction studies have reported contradictory results regarding the ability of T. foetus and T. vaginalis to interact with and damage cells of different tissues. In this study, parasite-host cell interactions were examined by culturing primary human fibroblasts obtained from abdominal biopsies performed during plastic surgeries with trichomonads. In addition, mouse 3T3 fibroblasts, primary chick embryo myogenic cells and L6 muscle cells were also used as models of target cells. The parasite-host cell cultures were processed for scanning and transmission electron microscopy and were tested for cell viability and cell death. JC-1 staining, which measures mitochondrial membrane potential, was used to determine whether the parasites induced target cell damage. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labelling staining was used as an indicator of chromatin damage. The colorimetric crystal violet assay was performed to ana-lyse the cytotoxicity induced by the parasite. The results showed that T. foetus and T. vaginalis adhered to and were cytotoxic to both fibroblasts and muscle cells, indicating that trichomonas infection of the connective and muscle tissues is likely to occur; such infections could cause serious risks to the infected host.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Experiments were carried out in vitro with three viscous polysaccharides (guar gum, pectin, and carboxymethylcellulose (CMC)) of similar initial viscosity submitted to conditions that mimic events occurring in the stomach and duodenum, and their viscosity in these situations was compared to their actions on postprandial hyperglycemia in normal human subjects. Guar gum showed greater viscosity than the other gums during acidification and/or alkalinization and also showed larger effects on plasma glucose levels (35% reduction in maximum rise in plasma glucose) and on the total area under the curve of plasma glucose (control: 20,314 ± 1007 mg dl-1 180 min-1 vs guar gum: 18,277 ± 699 mg dl-1 180 min-1, P<0.01). Pectin, which showed a marked reduction in viscosity at 37oC and after events mimicking those that occur in the stomach and duodenum, did not have a significant effect on postprandial hyperglycemia. The performance of viscosity and the glycemia response to CMC were at an intermediate level between guar gum and pectin. In conclusion, these data suggest that temperature, the process of acidification, alkalinization and exposure to intestinal ions induce different viscosity changes in gums having similar initial viscosity, establishing a direct relationship between a minor decrease of gum viscosity in vitro and a reduction of postprandial hyperglycemia

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The free form of the iron ion is one of the strongest oxidizing agents in the cellular environment. The effect of iron at different concentrations (0, 1, 5, 10, 50, and 100 µM Fe3+) on the normal human red blood cell (RBC) antioxidant system was evaluated in vitro by measuring total (GSH) and oxidized (GSSG) glutathione levels, and superoxide dismutase (SOD), catalase, glutathione peroxidase (GSH-Px) and reductase (GSH-Rd) activities. Membrane lipid peroxidation was assessed by measuring thiobarbituric acid reactive substance (TBARS). The RBC were incubated with colloidal iron hydroxide and phosphate-buffered saline, pH 7.45, at 37oC, for 60 min. For each assay, the results for the control group were: a) GSH = 3.52 ± 0.27 µM/g Hb; b) GSSG = 0.17 ± 0.03 µM/g Hb; c) GSH-Px = 19.60 ± 1.96 IU/g Hb; d) GSH-Rd = 3.13 ± 0.17 IU/g Hb; e) catalase = 394.9 ± 22.8 IU/g Hb; f) SOD = 5981 ± 375 IU/g Hb. The addition of 1 to 100 µM Fe3+ had no effect on the parameters analyzed. No change in TBARS levels was detected at any of the iron concentrations studied. Oxidative stress, measured by GSH kinetics over time, occurs when the RBC are incubated with colloidal iron hydroxide at concentrations higher than 10 µM of Fe3+. Overall, these results show that the intact human RBC is prone to oxidative stress when exposed to Fe3+ and that the RBC has a potent antioxidant system that can minimize the potential damage caused by acute exposure to a colloidal iron hydroxide in vitro.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Viruses share antigenic sites with normal host cell components, a phenomenon known as molecular mimicry. It has long been suggested that viral infections might trigger an autoimmune response by several mechanisms including molecular mimicry. More than 600 antiviral monoclonal antibodies generated against 11 different viruses have been reported to react with 3.5% of cells specific for uninfected mouse organs. The main pathological feature of tropical spastic paraparesis/human T-lymphotropic virus type I (HTLV-I)-associated myelopathy (TSP/HAM) is a chronic inflammation of the spinal cord characterized by perivascular cuffing of mononuclear cells accompanied by parenchymal lymphocytic infiltration. We detected the presence of autoantibodies against a 98- to 100-kDa protein of in vitro cultured human astrocytes and a 33- to 35-kDa protein from normal human brain in the serum of HTLV-I-seropositive individuals. The two cell proteins exhibited molecular mimicry with HTLV-I gag and tax proteins in TSP/HAM patients, respectively. Furthermore, the location of 33- to 35-kDa protein cross-reaction correlated with the anatomical spinal cord areas (in the rat model) in which axonal damage has been reported in several cases of TSP/HAM patients. Our experimental evidence strongly suggests that the demyelinating process occurring in TSP/HAM may be mediated by molecular mimicry between domains of some viral proteins and normal cellular targets of the spinal cord sections involved in the neurodegeneration.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The alpha2ß1 integrin is a major collagen receptor that plays an essential role in the adhesion of normal and tumor cells to the extracellular matrix. Alternagin-C (ALT-C), a disintegrin-like protein purified from the venom of the Brazilian snake Bothrops alternatus, competitively interacts with the alpha2ß1 integrin, thereby inhibiting collagen binding. When immobilized in plate wells, ALT-C supports the adhesion of fibroblasts as well as of human vein endothelial cells (HUVEC) and does not detach cells previously bound to collagen I. ALT-C is a strong inducer of HUVEC proliferation in vitro. Gene expression analysis was done using an Affimetrix HU-95A probe array with probe sets of ~10,000 human genes. In human fibroblasts growing on collagen-coated plates, ALT-C up-regulates the expression of several growth factors including vascular endothelial growth factor, as well as some cell cycle control genes. Up-regulation of the vascular endothelial growth factor gene and other growth factors could explain the positive effect on HUVEC proliferation. ALT-C also strongly activates protein kinase B phosphorylation, a signaling event involved in endothelial cell survival and angiogenesis. In human neutrophils, ALT-C has a potent chemotactic effect modulated by the intracellular signaling cascade characteristic of integrin-activated pathways. Thus, ALT-C acts as a survival factor, promoting adhesion, migration and endothelial cell proliferation after binding to alpha2ß1 integrin on the cell surface. The biological activities of ALT-C may be helpful as a therapeutic strategy in tissue regeneration as well as in the design of new therapeutic agents targeting alpha2ß1 integrin.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The amoebae's cytotoxicity test and the amoebae's lysis test were used to show possible interactions between rheumatoid factor (RF) and Entamoeba histolytica. Amoebae's cytotoxic activity (ACA) was inhibited by affinity chromatography purified antiamoebae rabbit IgG (RIgG). Enhanced inhibition could be demonstrated with RIgG plus RF. But the same marked inhibition of ACA could be seen when replacing RF by heat inactivated normal human serum as a control. About 50% amoebae's lysis occurred when amoebae were brought together with native normal human serum (NNHS) as a source of complement. Amoebae's lysis increased to 60% when incubated with NHS plus human antiamoebae antibodies. No further augmentation could be obtained by the addition of RF. Using RIgG instead of human antibodies the lysis rate did not increase. Incubation of amoebae, NNHS, RIgG and RF even reduced amoebae's lysis. RF neither has an effect on ACA nor on complement mediated AL in vitro.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Introduction The aim of this study was to explore the environment of Echinococcus granulosus (E. granulosus) protoscolices and their relationship with their host. Methods Proteins from the hydatid-cyst fluid (HCF) from E. granulosus were identified by proteomics. An inductively coupled plasma atomic emission spectrometer (ICP-AES) was used to determine the elements, an automatic biochemical analyzer was used to detect the types and levels of biochemical indices, and an automatic amino acid analyzer was used to detect the types and levels of amino acids in the E. granulosus HCF. Results I) Approximately 30 protein spots and 21 peptide mass fingerprints (PMF) were acquired in the two-dimensional gel electrophoresis (2-DE) pattern of hydatid fluid; II) We detected 10 chemical elements in the cyst fluid, including sodium, potassium, calcium, magnesium, copper, and zinc; III) We measured 19 biochemical metabolites in the cyst fluid, and the amount of most of these metabolites was lower than that in normal human serum; IV) We detected 17 free amino acids and measured some of these, including alanine, glycine, and valine. Conclusions We identified and measured many chemical components of the cyst fluid, providing a theoretical basis for developing new drugs to prevent and treat hydatid disease by inhibiting or blocking nutrition, metabolism, and other functions of the pathogen.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

A technics for prefreezing of blood plasma and serum is described in this paper. The method indicated by Strumia et al. (2), uses a rapid local freezing to obtain the shell-freezing, with refigerated alcohol bath, at temperatures around minus 35ºC. On our work, it has been found that normal horse blood plasma fulfils the instructions given by Strumia, although normal human blood plasma, very often, fails to give the expected results. This is very disadvantageous at the routine work. With the use of small amounts of solid carbon dioxide, spread over the flasks, in the refrigerated bath, it has been possible to start the chrystallization. The technics prescribes a rapid cooling, like the one used by Strumia, to bring the temperature down, to about plus 10ºC. and, with rotating device stopped, the solid carbon dioxide is applied for one minute simultaneously on each flask. Starting rotation again, it begins to form a very uniform shell around the walls of the flasks.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Schistosomula of Schistosoma mansoni became resistant to antibody-dependent complement damage in vitro after pre-incubation with normal human erythrocytes (NHuE) whatever the ABO or Rh blood group. Resistant parasites were shown to acquire host decay accelerating factor (DAF) , a 70 kDa glycoprotein attached to the membrane of NHue by a GPI anchor. IgG2a mAb anti-human DAF (IA10) immunoprecipitated a 70 kDa molecule from 125I-labeled schistosomula pre-incubated with NHuE and inhibited their resistance to complement-dependent killing in vtro. Incubationof schistosomula with erytrocytes from patients with paroxsimal nocturnal hemoglobinuria (PNHE) or SRBC, wich are DAF-deficient, did not protect the parasites from complement lesion. Supernatant of 100,000 x g collected from NHuE incubated for 24 h in defined medium was shown to contain a soluble form of DAF and to protect schistosomula from complement killing. Schistosomula treated with trypsin before incubation with NHuE ghosts did not become resistant to complement damage. On the other hand, pre-treatment with chymotrypsin did not interfere with the acquisition of resistance by the schistosomula. These results indicate that, in vitro, NHuE DAF can be transferred to schistosomula in a soluble form and that the binding of this molecule to the parasite surface is dependent upon trypsin-sensitive chymotrypsin-insensitive polipeptide(s) present on the surface of the worm.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

While normal human eosinophils are destroyed in vitro by virulent Entamoeba histolytica, notwhistanding the presence of antibodies and complement, activated eosinophils promptly destroy the parasite although dying also at the end of the process. To study the possible in vivo participation of eosinophils in invasive amebiasis, we compared the induction of experimental amebic abscess of the liver (AAL) in gerbils (Meriones unguiculatus) previously made eosinophilic through Toxocara canis antigen injection and in normal control gerbils. After intraportal inoculation of 10(5) ameba trophozoites (6 and 24 hr), the ratio of gerbils with AAL, as well as the number and size of the microabscesses was comparable in eosinophilic and control gerbils. However, at 96 hr the number and size of the microabscesses were significanly smaller (p<0.05) in eosinophilic gerbils. On the other hand the actuarial AAL survival curve up to 45 days post-amebic inoculation was signficantly (p<0.05) shifted to the right in controls. These results suggest that antigen-induced eosinophilia may exert a protective effect against AAL in gerbils.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Calophyllum brasiliense and Mammea americana (Clusiaceae) are two trees from the tropical rain forests of the American continent. A previous screening showed high trypanocidal activity in the extracts of these species. Several mammea-type coumarins, triterpenoids and biflavonoids were isolated from the leaves of C. brasiliense. Mammea A/AA was obtained from the fruit peels of M. americana. These compounds were tested in vitro against epimastigotes and trypomastigotes of Trypanosoma cruzi, the etiologic agent of Chagas disease. The most potent compounds were mammea A/BA, A/BB, A/AA, A/BD and B/BA, with MC100 values in the range of 15 to 90 g/ml. Coumarins with a cyclized ,-dimethylallyl substituent on C-6, such as mammea B/BA, cyclo F + B/BB cyclo F, and isomammeigin, showed MC100 values > 200 g/ml. Several active coumarins were also tested against normal human lymphocytes in vitro, which showed that mammea A/AA and A/BA were not toxic. Other compounds from C. brasiliense, such as the triterpenoids, friedelin, canophyllol, the biflavonoid amentoflavone, and protocatechuic and shikimic acids, were inactive against the epimastigotes. The isopropylidenedioxy derivative of shikimic acid was inactive, and its structure was confirmed by X-ray diffraction. Our results suggest that mammea-type coumarins could be a valuable source of trypanocidal compounds.