100 resultados para MOLECULAR-CLONING

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The a-globin major genes from diploid and tetraploid Odontophrynus americanus were studied using PCR-based technology. The cloned and sequenced amplified fragments were shown to contain most of the exon II sequences as well as the whole exon III sequence of the a-globin gene. Unexpectedly, intron 2 was entirely absent in the amplified fragments of both 2n and 4n origin. High conservation was observed among the obtained sequences when compared to corresponding sequences from human and Xenopus laevis origin. The possibility that these sequences might be pseudogenes is raised

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Context and objective:The molecular characterization of local isolates of Toxoplasma gondii is considered significant so as to assess the homologous variations between the different loci of various strains of parasites.Design and setting:The present communication deals with the molecular cloning and sequence analysis of the 1158 bp entire open reading frame (ORF) of surface antigen 3 (SAG3) of two Indian T. gondii isolates (Chennai and Izatnagar) being maintained as cryostock at the IVRI.Method:The surface antigen 3 (SAG3) of two local Indian isolates were cloned and sequenced before being compared with the available published sequences.Results:The sequence comparison analysis revealed 99.9% homology with the standard published RH strain sequence of T. gondii. The strains were also compared with other established published sequences and found to be most related to the P-Br strain and CEP strain (both 99.3%), and least with PRU strain (98.4%). However, the two Indian isolates had 100% homology between them.Conclusion:Finally, it was concluded that the Indian isolates were closer to the RH strain than to the P-Br strain (Brazilian strain), the CEP strain and the PRU strains (USA), with respect to nucleotide homology. The two Indian isolates used in the present study are known to vary between themselves, as far as homologies related to other genes are concerned, but they were found to be 100% homologous as far as SAG3 locus is concerned. This could be attributed to the fact that this SAG3 might be a conserved locus and thereby, further detailed studies are thereby warranted to exploit the use of this particular molecule in diagnostics and immunoprophylactics. The findings are important from the point of view of molecular phylogeny.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The modern approach to the development of new chemical entities against complex diseases, especially the neglected endemic diseases such as tuberculosis and malaria, is based on the use of defined molecular targets. Among the advantages, this approach allows (i) the search and identification of lead compounds with defined molecular mechanisms against a defined target (e.g. enzymes from defined pathways), (ii) the analysis of a great number of compounds with a favorable cost/benefit ratio, (iii) the development even in the initial stages of compounds with selective toxicity (the fundamental principle of chemotherapy), (iv) the evaluation of plant extracts as well as of pure substances. The current use of such technology, unfortunately, is concentrated in developed countries, especially in the big pharma. This fact contributes in a significant way to hamper the development of innovative new compounds to treat neglected diseases. The large biodiversity within the territory of Brazil puts the country in a strategic position to develop the rational and sustained exploration of new metabolites of therapeutic value. The extension of the country covers a wide range of climates, soil types, and altitudes, providing a unique set of selective pressures for the adaptation of plant life in these scenarios. Chemical diversity is also driven by these forces, in an attempt to best fit the plant communities to the particular abiotic stresses, fauna, and microbes that co-exist with them. Certain areas of vegetation (Amazonian Forest, Atlantic Forest, Araucaria Forest, Cerrado-Brazilian Savanna, and Caatinga) are rich in species and types of environments to be used to search for natural compounds active against tuberculosis, malaria, and chronic-degenerative diseases. The present review describes some strategies to search for natural compounds, whose choice can be based on ethnobotanical and chemotaxonomical studies, and screen for their ability to bind to immobilized drug targets and to inhibit their activities. Molecular cloning, gene knockout, protein expression and purification, N-terminal sequencing, and mass spectrometry are the methods of choice to provide homogeneous drug targets for immobilization by optimized chemical reactions. Plant extract preparations, fractionation of promising plant extracts, propagation protocols and definition of in planta studies to maximize product yield of plant species producing active compounds have to be performed to provide a continuing supply of bioactive materials. Chemical characterization of natural compounds, determination of mode of action by kinetics and other spectroscopic methods (MS, X-ray, NMR), as well as in vitro and in vivo biological assays, chemical derivatization, and structure-activity relationships have to be carried out to provide a thorough knowledge on which to base the search for natural compounds or their derivatives with biological activity.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Entamoeba histolytica, the protozoan parasite causing human amoebisis, has recently been found to comprise two genetically distinct forms, potentially pathogenic and constitutively nonpathogenic ones. Host tissue destruction by pathogenic forms is belived to result from cell functions mediaed by a lectin-type adherence receptor, a pore-forming peptide involved in host cell lysis, and abundant expression of cysteine proteinase(s). Isolation and molecular cloning of these amoeba products have provided the tools for structural analyses and manipulations of cell functions including comparisons between pathogenic and nonpathogenic forms.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Schistosomiasis is a chronic and debilitating parasitic disease that affects over 200 million people throughout the world and causes about 500,000 deaths annually. Two specific characteristics of schistosome infection are of primordial importance to the development of a vaccine: schistosomes do not multiply within the tissues of their definitive hosts (unlike protozoan parasites) and a partial non-sterilizing immunity can have a marked effect on the incidence of pathology and on disease transmission. Since viable eggs are the cause of disease pathology, a reduction in worm fecundity whether or not accompanied by a reduction in parasite burden is a sufficient goal for vaccine induced immunity. We originally showed that IgE antibodies played in experimental models a pivotal role for the development of protective immunity. These laboratory findings have been now confirmed in human populations. Following the molecular cloning and expression of a protein 28 kDa protein of Schistosoma mansoni and its identification as a glutathion S-transferase, immunization experiments have been undertaken in several animal species (rats, mice, baboons). Together with a significant reduction in parasite burden, vaccination with Sm28 GST was recently shown to reduce significantly parasite fecundity and egg viability leading to a decrease in liver pathology. Whereas IgE antibodies were shown to be correlated with protection against infection, IgA antibodies have been identified as one of the factors affecting egg laying and viability. In human populations, a close association was found between IgA antibody production to Sm28 GST and the decrease of egg output. The use of appropriate monoclonal antibody probes has allowed the demonstration that the inhibition of parasite fecundity following immunization was related to the inhibition of enzymatic activity of the molecule. Epitope mapping of Sm28 GST has indicated the prominent role of the N and C terminal domains. Immunization with the corresponding synthetic peptides was followed by a decrease of 70% of parasite fecundity and egg viability. As a preliminary step towards phase I human trials, vaccination experiments have been performed in cattle, a natural model for Schistosoma bovis. Vaccination of calves with the S. bovis GST has led to a reduction of ever 80% of egg output and tissue egg count. Significant levels of protection were also observed in goats after immunization with the recombinant S. bovis GST. Increasing evidence of the participation of IgA antibodies in protective immunity has prompted us toward the development of mucosal immunization. Preliminary results indicate that significant levels of protection can be achieved following oral immunization with live attenuated vectors or liposomes. These studies seem to represent a promising approach towards the future development of a vaccine strategy against one of major human parasitic diseases.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Molecular cloning of components of protective antigenic preparations have suggested that related parasite fatty acid binding proteins could form the basis of the well documented protective, immune cross reactivity between the parasitic trematode worms Fasciola hepatica and Schistosoma mansoni. We have now confirmed the cross protective potential of parasite fatty acid binding proteins and suggest that it may be possible to produce a single vaccine that would be effective against at least two parasites, F. hepatica and S. mansoni of veterinary and human importance respectively.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Dengue virulence and fitness are important factors that determine disease outcome. However, dengue virus (DENV) molecular biology and pathogenesis are not completely elucidated. New insights on those mechanisms have been facilitated by the development of reverse genetic systems in the past decades. Unfortunately, instability of flavivirus genomes cloned in Escherichia coli has been a major problem in these systems. Here, we describe the development of a complete reverse genetics system, based on the construction of an infectious clone and replicon for a low passage DENV-3 genotype III of a clinical isolate. Both constructs were assembled into a newly designed yeast- E. coli shuttle vector by homologous recombination technique and propagated in yeast to prevent any possible genome instability in E. coli . RNA transcripts derived from the infectious clone are infectious upon transfection into BHK-21 cells even after repeated passages of the plasmid in yeast. Transcript-derived DENV-3 exhibited growth kinetics, focus formation size comparable to original DENV-3 in mosquito C6/36 cell culture. In vitro characterisation of DENV-3 replicon confirmed its identity and ability to replicate transiently in BHK-21 cells. The reverse genetics system reported here is a valuable tool that will facilitate further molecular studies in DENV replication, virus attenuation and pathogenesis.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Guanylate cyclases (GC) serve in two different signaling pathways involving cytosolic and membrane enzymes. Membrane GCs are receptors for guanylin and atriopeptin peptides, two families of cGMP-regulating peptides. Three subclasses of guanylin peptides contain one intramolecular disulfide (lymphoguanylin), two disulfides (guanylin and uroguanylin) and three disulfides (E. coli stable toxin, ST). The peptides activate membrane receptor-GCs and regulate intestinal Cl- and HCO3- secretion via cGMP in target enterocytes. Uroguanylin and ST also elicit diuretic and natriuretic responses in the kidney. GC-C is an intestinal receptor-GC for guanylin and uroguanylin, but GC-C may not be involved in renal cGMP pathways. A novel receptor-GC expressed in the opossum kidney (OK-GC) has been identified by molecular cloning. OK-GC cDNAs encode receptor-GCs in renal tubules that are activated by guanylins. Lymphoguanylin is highly expressed in the kidney and heart where it may influence cGMP pathways. Guanylin and uroguanylin are highly expressed in intestinal mucosa to regulate intestinal salt and water transport via paracrine actions on GC-C. Uroguanylin and guanylin are also secreted from intestinal mucosa into plasma where uroguanylin serves as an intestinal natriuretic hormone to influence body Na+ homeostasis by endocrine mechanisms. Thus, guanylin peptides control salt and water transport in the kidney and intestine mediated by cGMP via membrane receptors with intrinsic guanylate cyclase activity.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The human nuclear protein RbAp48 is a member of the tryptophan/aspartate (WD) repeat family, which binds to the retinoblastoma (Rb) protein. It also corresponds to the smallest subunit of the chromatin assembly factor and is able to bind to the helix 1 of histone H4, taking it to the DNA in replication. A cDNA homologous to the human gene RbAp48 was isolated from a Schistosoma mansoni adult worm library and named SmRbAp48. The full length sequence of SmRbAp48 cDNA is 1036 bp long, encoding a protein of 308 amino acids. The transcript of SmRbAp48 was detected in egg, cercariae and schistosomulum stages. The protein shows 84% similarity with the human RbAp48, possessing four WD repeats on its C-terminus. A hypothetical tridimensional structure for the SmRbAp48 C-terminal domain was constructed by computational molecular modeling using the b-subunit of the G protein as a model. To further verify a possible interaction between SmRbAp48 and S. mansoni histone H4, the histone H4 gene was amplified from adult worm genomic DNA using degenerated primers. The gene fragment of SmH4 is 294 bp long, encoding a protein of 98 amino acids which is 100% identical to histone H4 from Drosophila melanogaster.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Small nuclear RNAs (snRNAs) are important factors in the functioning of eukaryotic cells that form several small complexes with proteins; these ribonucleoprotein particles (U snRNPs) have an essential role in the pre-mRNA processing, particularly in splicing, catalyzed by spliceosomes, large RNA-protein complexes composed of various snRNPs. Even though they are well defined in mammals, snRNPs are still not totally characterized in certain trypanosomatids as Trypanosoma cruzi. For this reason we subjected snRNAs (U2, U4, U5, and U6) from T. cruzi epimastigotes to molecular characterization by polymerase chain reaction (PCR) and reverse transcription-PCR. These amplified sequences were cloned, sequenced, and compared with those other of trypanosomatids. Among these snRNAs, U5 was less conserved and U6 the most conserved. Their respective secondary structures were predicted and compared with known T. brucei structures. In addition, the copy number of each snRNA in the T. cruzi genome was characterized by Southern blotting.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Numerous proteinase activities have been shown to be essential for the survival of Plasmodium falciparum. One approach to antimalarial chemotherapy, would be to block specifically one or several of these activities, by using compounds structurally analogous to the substrates of these proteinases. Such a strategy requires a detailed knowledge of the active site of the proteinase, in order to identify the best substrate for the proteinase. Aiming at developing such a strategy, two proteinases previously identified in our laboratory, were chosen for further characterization of their molecular structure and properties: the merozoite proteinase for erythrocytic invasion (MPEI), involved in the erythrocyte invasion by the merozoites, and the Pf37 proteinase, which hydrolyses human spectrin in vitro.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The zinc finger motifs (Cys2His2) are found in several proteins playing a role in the regulation of transcripton. SmZF1, a Schistosoma mansoni gene encoding a zinc finger protein was initially isolated from an adult worm cDNA library, as a partial cDNA. The full sequence of the gene was obtained by subcloning and sequencing cDNA and genomic fragments. The collated gene sequence is 2181 nt and the complete cDNA sequence is 705 bp containing the full open reading frame of the gene. Analysis of the genome sequence revealed the presence of three introns interrupting the coding region. The open reading frame theoretically encodes a protein of 164 amino acids, with a calculated molecular mass of 18,667Da. The predicted protein contains three zinc finger motifs, usually present in transcription regulatory proteins. PCR amplification with specific primers for the gene allowed for the detection of the target in egg, cercariae, schistosomulum and adult worm cDNA libraries indicating the expression of the mRNA in these life cycle stages of S. mansoni. This pattern of expression suggests the gene plays a role in vital functions of different life cycle stages of the parasite. Future research will be directed to elucidate the functional role of SmZF1.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Diesel oil is a compound derived from petroleum, consisting primarily of hydrocarbons. Poor conditions in transportation and storage of this product can contribute significantly to accidental spills causing serious ecological problems in soil and water and affecting the diversity of the microbial environment. The cloning and sequencing of the 16S rRNA gene is one of the molecular techniques that allows estimation and comparison of the microbial diversity in different environmental samples. The aim of this work was to estimate the diversity of microorganisms from the Bacteria domain in a consortium specialized in diesel oil degradation through partial sequencing of the 16S rRNA gene. After the extraction of DNA metagenomics, the material was amplified by PCR reaction using specific oligonucleotide primers for the 16S rRNA gene. The PCR products were cloned into a pGEM-T-Easy vector (Promega), and Escherichia coli was used as the host cell for recombinant DNAs. The partial clone sequencing was obtained using universal oligonucleotide primers from the vector. The genetic library obtained generated 431 clones. All the sequenced clones presented similarity to phylum Proteobacteria, with Gammaproteobacteria the most present group (49.8 % of the clones), followed by Alphaproteobacteira (44.8 %) and Betaproteobacteria (5.4 %). The Pseudomonas genus was the most abundant in the metagenomic library, followed by the Parvibaculum and the Sphingobium genus, respectively. After partial sequencing of the 16S rRNA, the diversity of the bacterial consortium was estimated using DOTUR software. When comparing these sequences to the database from the National Center for Biotechnology Information (NCBI), a strong correlation was found between the data generated by the software used and the data deposited in NCBI.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Efetuou-se a clonagem e seqüenciamento do gene que codifica a proteína capsidial de dois isolados do vírus do mosaico da alface (Lettuce mosaic virus, LMV) provenientes do estado de São Paulo, previamente caracterizados como pertencentes aos patótipos II (AF198, incapaz de infetar cultivares com os genes de resistência mo1¹ ou mo1²) e IV (AF199, capaz de quebrar a resistência propiciada pelos genes mo1¹ e mo1²), com base na virulência em cultivares diferenciadoras. Análise comparativa das seqüências de nucleotídeos de isolados provenientes da Europa, América do Norte, Oriente Médio e os dois isolados brasileiros não permitiu sua separação em estirpes, pois as porcentagens de homologia foram sempre superiores a 95%. Entretanto, análise filogenética dos isolados sugere uma origem comum entre o isolado AF-198 e os isolados LMV-R e LMV-0 (patótipo II, provenientes dos Estados Unidos e da França, respectivamente). O isolado AF199 apresentou uma alta homologia de seqüência com os isolados LMV-Aud e LMV-13, ambos provenientes da França. Esses isolados também são relacionados a isolados provenientes do Chile, embora uma origem comum não seja proposta. Eventos independentes de mutação podem estar ocorrendo em diferentes partes do mundo, propiciando o surgimento de novas estirpes de LMV capazes de quebrar a resistência conferida pelos genes mo1¹ e mo1².