33 resultados para LDL-Receptor Related Proteins
em Scielo Saúde Pública - SP
Resumo:
Low-density lipoprotein (LDL) receptors are overexpressed in most neoplastic cell lines and provide a mechanism for the internalization and concentration of drug-laden nanoemulsions that bind to these receptors. The aim of the present study was to determine whether the administration of standard chemotherapeutic schemes can alter the expression of LDL and LDL receptor-related protein 1 (LRP-1) receptors in breast carcinoma. Fragments of tumoral and normal breast tissue from 16 consecutive volunteer women with breast cancer in stage II or III were obtained from biopsies before the beginning of neoadjuvant chemotherapy and after chemotherapy, from fragments excised during mastectomy. Tissues were analyzed by immunohistochemistry for both receptors. Because complete response to treatment was achieved in 4 patients, only the tumors from 12 were analyzed. Before chemotherapy, there was overexpression of LDL receptor in the tumoral tissue compared to normal breast tissue in 8 of these patients. LRP-1 receptor overexpression was observed in tumors of 4 patients. After chemotherapy, expression of both receptors decreased in the tumors of 6 patients, increased in 4 and was unchanged in 2. Nonetheless, even when chemotherapy reduced receptors expression, the expression was still above normal. The fact that chemotherapy does not impair LDL receptors expression supports the use of drug carrier systems that target neoplastic cells by the LDL receptor endocytic pathway in patients on conventional chemotherapy.
Resumo:
Background: Familial hypercholesterolemia (FH) is an autosomal dominant genetic disease characterized by an elevation in the serum levels of total cholesterol and of low-density lipoproteins (LDL- c). Known to be closely related to the atherosclerotic process, FH can determine the development of early obstructive lesions in different arterial beds. In this context, FH has also been proposed to be a risk factor for peripheral arterial disease (PAD). Objective: This observational cross-sectional study assessed the association of PAD with other manifestations of cardiovascular disease (CVD), such as coronary artery and cerebrovascular disease, in patients with heterozygous FH. Methods: The diagnosis of PAD was established by ankle-brachial index (ABI) values ≤ 0.90. This study assessed 202 patients (35% of men) with heterozygous FH (90.6% with LDL receptor mutations), mean age of 51 ± 14 years and total cholesterol levels of 342 ± 86 mg /dL. Results: The prevalences of PAD and previous CVD were 17% and 28.2 %, respectively. On multivariate analysis, an independent association between CVD and the diagnosis of PAD was observed (OR = 2.50; 95% CI: 1.004 - 6.230; p = 0.049). Conclusion: Systematic screening for PAD by use of ABI is feasible to assess patients with FH, and it might indicate an increased risk for CVD. However, further studies are required to determine the role of ABI as a tool to assess the cardiovascular risk of those patients.
Resumo:
Sm14 was the first fatty acid-binding protein homologue identified in helminths. Thereafter, members of the same family were identified in several helminth species, with high aminoacid sequence homology between them. In addition, immune crossprotection was also reported against Fasciola hepatica infection, in animals previously immunized with the Schistosoma mansoni vaccine candidate, r-Sm14. In the present study, data on preliminary sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting analysis of nine different helminth extracts focusing the identification of Sm14 related proteins, is reported. Out of these, three extracts - Ascaris suum (males and females), Echinostoma paraensei, and Taenia saginata - presented components that comigrated with Sm14 in SDS-PAGE, and that were recognized by anti-rSm14 policlonal serum, in Western blotting tests.
Resumo:
Chagas disease (CD) causes the highest burden of parasitic diseases in the Western Hemisphere and is therefore a priority for drug research and development. Platelet-activating factor (PAF) causes the CD parasite Trypanosoma cruzi to differentiate, which suggests that the parasite may express PAF receptors. Here, we explored the T. cruzi proteome for PAF receptor-like proteins. From a total of 23,000 protein sequences, we identified 29 hypothetical proteins that are predicted to have seven transmembrane domains (TMDs), which is the main characteristic of the G protein-coupled receptors (GPCRs), including the PAF receptor. The TMDs of these sequences were independently aligned with domains from 25 animal PAF receptors and the sequences were analysed for conserved residues. The conservation score mean values for the TMDs of the hypothetical proteins ranged from 31.7-44.1%, which suggests that if the putative T. cruzi PAF receptor is among the sequences identified, the TMDs are not highly conserved. These results suggest that T. cruzi contains several GPCR-like proteins and that one of these GPCRs may be a PAF receptor. Future studies may further validate the PAF receptor as a target for CD chemotherapy.
Resumo:
Familial hypercholesterolemia (FH) is a metabolic disorder inherited as an autosomal dominant trait characterized by an increased plasma low-density lipoprotein (LDL) level. The disease is caused by several different mutations in the LDL receptor gene. Although early identification of individuals carrying the defective gene could be useful in reducing the risk of atherosclerosis and myocardial infarction, the techniques available for determining the number of the functional LDL receptor molecules are difficult to carry out and expensive. Polymorphisms associated with this gene may be used for unequivocal diagnosis of FH in several populations. The aim of our study was to evaluate the genotype distribution and relative allele frequencies of three polymorphisms of the LDL receptor gene, HincII1773 (exon 12), AvaII (exon 13) and PvuII (intron 15), in 50 unrelated Brazilian individuals with a diagnosis of heterozygous FH and in 130 normolipidemic controls. Genomic DNA was extracted from blood leukocytes by a modified salting-out method. The polymorphisms were detected by PCR-RFLP. The FH subjects showed a higher frequency of A+A+ (AvaII), H+H+ (HincII1773) and P1P1 (PvuII) homozygous genotypes when compared to the control group (P<0.05). In addition, FH probands presented a high frequency of A+ (0.58), H+ (0.61) and P1 (0.78) alleles when compared to normolipidemic individuals (0.45, 0.45 and 0.64, respectively). The strong association observed between these alleles and FH suggests that AvaII, HincII1773 and PvuII polymorphisms could be useful to monitor the inheritance of FH in Brazilian families.
Resumo:
Curcumin, a major yellow pigment and active component of turmeric, has multiple anti-cancer properties. However, its molecular targets and mechanisms of action on human colon adenocarcinoma cells are unknown. In the present study, we examined the effects of curcumin on the proliferation of human colon adenocarcinoma HT-29 cells by the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide method and confirmed the curcumin-induced apoptosis by morphology and DNA ladder formation. At the same time, p53, phospho-p53 (Ser15), and other apoptosis-related proteins such as Bax, Bcl-2, Bcl-xL, pro-caspase-3, and pro-caspase-9 were determined by Western blot analysis. The colon adenocarcinoma cells were treated with curcumin (0-75 µM) for 0-24 h. We observed that p53 was highly expressed in HT-29 cells and curcumin could up-regulate the serine phosphorylation of p53 in a time- and concentration-dependent manner. An increase in expression of the pro-apoptotic factor Bax and a decrease in expression of the anti-apoptotic factor Bcl-2 were also observed in a time-dependent manner after exposure of 50 µM curcumin, while the expression of the anti-apoptotic factor Bcl-xL was unchanged. Curcumin could also down-regulate the expression of pro-caspase-3 and pro-caspase-9 in a time-dependent manner. These data suggest a possible underlying molecular mechanism whereby curcumin could induce the apoptosis signaling pathway in human HT-29 colon adenocarcinoma cells by p53 activation and by the regulation of apoptosis-related proteins. This property of curcumin suggests that it could have a possible therapeutic potential in colon adenocarcinoma patients.
Resumo:
The regulatory function of α1B-adrenoceptors in mammalian heart homeostasis is controversial. The objective of the present study was to characterize the expression/activity of key proteins implicated in cardiac calcium handling (Na+/K+-ATPase and Ca2+-ATPases) and growth (ERK1/2, JNK1/2 and p38) in mice with cardiac-selective overexpression of constitutively active mutant α1B-adrenoceptor (CAMα1B-AR), which present a mild cardiac hypertrophy phenotype. Immunoblot assays showed that myocardial plasma membrane Ca2+-ATPase (PMCA) expression was increased by 30% in CAMα1B-AR mice (N = 6, P < 0.05), although there was no change in sarco/endoplasmic reticulum Ca2+-ATPase (SERCA2) expression. Moreover, total Ca2+-ATPase activity was not modified, but a significant increase in the activity of the thapsigargin-resistant (PMCA) to thapsigargin-sensitive (SERCA) ratio was detected. Neither Na+/K+-ATPase activity nor the expression of α1 and α2 subunit isoforms was changed in CAMα1B-AR mouse hearts. Moreover, immunoblot assays did not provide evidence for an enhanced activation of the three mitogen-activated protein kinases studied in this stage of hypertrophy. Therefore, these findings indicate that chronic cardiac α1B-AR activation in vivo led to mild hypertrophy devoid of significant signs of adaptive modifications concerning primary intracellular calcium control and growth-related proteins, suggesting a minor pathophysiological role of this adrenergic receptor in mouse heart at this stage of development.
Resumo:
Inhibition of type-5 phosphodiesterase by sildenafil decreases capacitative Ca2+ entry mediated by transient receptor potential proteins (TRPs) in the pulmonary artery. These families of channels, especially the canonical TRP (TRPC) subfamily, may be involved in the development of bronchial hyperresponsiveness, a hallmark of asthma. In the present study, we evaluated i) the effects of sildenafil on tracheal rings of rats subjected to antigen challenge, ii) whether the extent of TRPC gene expression may be modified by antigen challenge, and iii) whether inhibition of type-5 phosphodiesterase (PDE5) may alter TRPC gene expression after antigen challenge. Sildenafil (0.1 µM to 0.6 mM) fully relaxed carbachol-induced contractions in isolated tracheal rings prepared from naive male Wistar rats (250-300 g) by activating the NO-cGMP-K+ channel pathway. Rats sensitized to antigen by intraperitoneal injections of ovalbumin were subjected to antigen challenge by ovalbumin inhalation, and their tracheal rings were used to study the effects of sildenafil, which more effectively inhibited contractions induced by either carbachol (10 µM) or extracellular Ca2+ restoration after thapsigargin (1 µM) treatment. Antigen challenge increased the expression of the TRPC1 and TRPC4 genes but not the expression of the TRPC5 and TRPC6 genes. Applied before the antigen challenge, sildenafil increased the gene expression, which was evaluated by RT-PCR, of TRPC1 and TRPC6, decreased TRPC5 expression, and was inert against TRPC4. Thus, we conclude that PDE5 inhibition is involved in the development of an airway hyperresponsive phenotype in rats after antigen challenge by altering TRPC gene expression.
Resumo:
Cytochrome p450s (cyp450s) are a family of structurally related proteins, with diverse functions, including steroid synthesis and breakdown of toxins. This paper reports the full-length sequence of a novel cyp450 gene, the first to be isolated from the tropical freshwater snail Biomphalaria glabrata, an important intermediate host of Schistosoma mansoni. The nucleotide sequence is 2291 bp with a predicted amino acid sequence of 584aa. The sequence demonstrates conserved cyp450 structural motifs, but is sufficiently different from previously reported cyp450 sequences to be given a new classification, CYP320A1. Initially identified as down-regulated in partially resistant snails in response to S. mansoni infection, amplification of this gene using RT-PCR in both totally resistant or susceptible snail lines when exposed to infection, and all tissues examined, suggests ubiquitous expression. Characterization of the first cyp450 from B. glabrata is significant in understanding the evolution of these metabolically important proteins.
Resumo:
Familial hypercholesterolemia (FH) is a common autosomal disorder that affects about one in 500 individuals in most Western populations and is caused by a defect in the low-density-lipoprotein receptor (LDLr) gene. In this report we determined the molecular basis of FH in 59 patients from 31 unrelated Brazilian families. All patients were screened for the Lebanese mutation, gross abnormalities of the LDLr gene, and the point mutation in the codon 3500 of the apolipoprotein B-100 gene. None of the 59 patients presented the apoB-3500 mutation, suggesting that familial defective ApoB-100 (FDB) is not a major cause of inherited hypercholesterolemia in Brazil. A novel 4-kb deletion in the LDLr gene, spanning from intron 12 to intron 14, was characterized in one family. Both 5' and 3' breakpoint regions were located within Alu repetitive sequences, which are probably involved in the crossing over that generated this rearrangement. The Lebanese mutation was detected in 9 of the 31 families, always associated with Arab ancestry. Two different LDLr gene haplotypes were demonstrated in association with the Lebanese mutation. Our results suggest the importance of the Lebanese mutation as a cause of FH in Brazil and by analogy the same feature may be expected in other countries with a large Arab population, such as North American and Western European countries.
Resumo:
Acute myelogenous leukemia (AML) blast cells show high-affinity degradation of low-density lipoprotein (LDL), suggesting an increased expression of cellular LDL receptors. LDE is a lipid microemulsion easily synthesized in vitro which is known to mimic the metabolic pathway of LDL. We used LDE as a carrier for daunorubicin and assayed the cytotoxicity of the complex using AML blast cells since RT-PCR analysis showed that AML cells express LDL receptor mRNA. The LDE:daunorubicin complex killed 46.7% of blast cells and 20.2% of normal bone marrow cells (P<0.001; Student t-test). Moreover, this complex destroyed AML blast cells as efficiently as free daunorubicin. Thus, LDE might be a suitable carrier of chemotherapeutic agents targeting these drugs to neoplastic cells and protecting normal tissues.
Resumo:
Pequi is the fruit of Caryocar brasiliense and its oil has a high concentration of monounsaturated and saturated fatty acids, which are anti- and pro-atherogenic agents, respectively, and of carotenoids, which give it antioxidant properties. Our objective was to study the effect of the intake of a cholesterol-rich diet supplemented with pequi oil, compared to the same diet containing soybean oil, on atherosclerosis development, and oxidative stress in atherosclerosis-susceptible LDL receptor-deficient mice (LDLr-/-, C57BL/6-background). Female mice were fed a cholesterol-rich diet containing 7% soybean oil (Soybean group, N = 12) or 7% pequi oil (Pequi group, N = 12) for 6 weeks. The Pequi group presented a more atherogenic lipid profile and more advanced atherosclerotic lesions in the aortic root compared to the Soybean group. However, the Pequi group presented a less advanced lesion in the aorta than the Soybean group and showed lower lipid peroxidation (Soybean group: 50.2 ± 7.1; Pequi group: 30.0 ± 4.8 µmol MDA/mg protein) and anti-oxidized LDL autoantibodies (Soybean group: 35.7 ± 9.4; Pequi group: 15.6 ± 3.7 arbitrary units). Peritoneal macrophages from the Pequi group stimulated with zymosan showed a reduction in the release of reactive oxygen species compared to the Soybean group. Our data suggest that a pequi oil-rich diet slows atherogenesis in the initial stages, possibly due to its antioxidant activity. However, the increase of serum cholesterol induces a more prominent LDL migration toward the intimae of arteries, increasing the advanced atherosclerotic plaque. In conclusion, pequi oil associated with an atherogenic diet worsens the lipid profile and accelerates the formation of advanced atherosclerotic lesions despite its antioxidant action.
Resumo:
Rhein is a primary anthraquinone found in the roots of a traditional Chinese herb, rhubarb, and has been shown to have some anticancer effects. The aim of the present study was to investigate the effect of rhein on the apoptosis of the human gastric cancer line SGC-7901 and to identify the mechanism involved. SGC-7901 cells were cultured and treated with rhein (0, 50, 100, 150, and 200 µM) for 24, 48, or 72 h. Relative cell viability assessed by the MTT assay after treatment was 100, 99, 85, 79, 63% for 24 h; 100, 98, 80, 51, 37% for 48 h, and 100, 97, 60, 36, 15% for 72 h, respectively. Cell apoptosis was detected with TUNEL staining and quantified with flow cytometry using annexin FITC-PI staining at 48 h after 100, 200 and 300 µm rhein. The percentage of apoptotic cells was 7.3, 21.9, 43.5%, respectively. We also measured the mRNA levels of caspase-3 and -9 using real-time PCR. Treatment with 100 µM rhein for 48 h significantly increased mRNA expression of caspase-3 and -9. The levels of apoptosis-related proteins including Bcl-2, Bax, Bcl-xL, and pro-caspase-3 were evaluated in rhein-treated cells. Rhein increased the Bax:Bcl-2 ratio but decreased the protein levels of Bcl-xL and pro-caspase-3. Moreover, rhein significantly increased the expression of cytochrome c and apoptotic protease activating factor 1, two critical components involved in mitochondrial pathway-mediated apoptosis. We conclude that rhein inhibits SGC-7901 proliferation by inducing apoptosis and this antitumor effect of rhein is mediated in part by an intrinsic mitochondrial pathway.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.