46 resultados para Impairs Endocytosis
em Scielo Saúde Pública - SP
Resumo:
Trypanomastigote forms of Trypanosoma cruzi were derived from tissue culture and incubated with immune and non-immune human sera. All immune sera showed high titers of specific humoral antibodies of the IgM or the IgG type. Agglutination and swelling of parasites were observed after incubation at 37ºC, but many trypomastigotes remained free-swimming in the sera for two to three days. The quantitiy of immune serum capable of lysing a maximum of 10 x 10 [raised to the power of 6] sensitized red cells was not capable of lysing 4 x 10 [raised to the power of 3] tripomastigotes. Typically, the parasites underwent cyclical changes with the formation of clumps of amastigotes and the appearance of epimastigote forms. Multiplication of the parasites was observed in immune sera. Further, the infectivity of the parasites to susceptible mice was not lost. All sera used produced similar general effects on the growth of the parasite. The antibody bound to T. cruzi appeard to enter cells by antigen-receptor mediated endocytosis. The ferritin-conjugated antibody was internalized and delivered to phagolysosomes where they might be completely degraded to amino-acids. This seemed to be a coupled process by which the immunoglobulin is first bound to specific parasite surface receptor and then rapidly endocytosed by the cell.
Resumo:
Enteropathogenic E. coli (EPEC) infection of Hep-2 cells preoceeds through bacterial attachment to cell surface and internalization of adhered bacteria. EPEC attachment is a prerequisite for cell infection and is mediated by adhesins that recognize carbohydrate-containing receptors on cell membrane. Such endocytosis-inducer adhesins (EIA) also promote EPEC binding to infant enterocytes, suggesting that EIA may have an important role on EPEC gastroenteritis.
Resumo:
Calcium oxalate (CaOx) crystals adhere to and are internalized by tubular renal cells and it seems that this interaction is related (positively or negatively) to the appearance of urinary calculi. The present study analyzes a series of mechanisms possibly involved in CaOx uptake by Madin-Darby canine kidney (MDCK) cells. CaOx crystals were added to MDCK cell cultures and endocytosis was evaluated by polarized light microscopy. This process was inhibited by an increase in intracellular calcium by means of ionomycin (100 nM; N = 6; 43.9% inhibition; P<0.001) or thapsigargin (1 µM; N = 6; 33.3% inhibition; P<0.005) administration, and via blockade of cytoskeleton assembly by the addition of colchicine (10 µM; N = 8; 46.1% inhibition; P<0.001) or cytochalasin B (10 µM; N = 8; 34.2% inhibition; P<0.001). Furthermore, CaOx uptake was reduced when the activity of protein kinase C was inhibited by staurosporine (10 nM; N = 6; 44% inhibition; P<0.01), or that of cyclo-oxygenase by indomethacin (3 µM; N = 12; 17.2% inhibition; P<0.05); however, the uptake was unaffected by modulation of potassium channel activity with glibenclamide (3 µM; N = 6), tetraethylammonium (1 mM; N = 6) or cromakalim (1 µM; N = 6). Taken together, these data indicate that the process of CaOx internalization by renal tubular cells is similar to the endocytosis reported for other systems. These findings may be relevant to cellular phenomena involved in early stages of the formation of renal stones.
Resumo:
A construct (AT1R-NF) containing a "Flag" sequence added to the N-terminus of the rat AT1 receptor was stably expressed in Chinese hamster ovary cells and quantified in the cell membrane by confocal microscopy after reaction with a fluorescein-labeled anti-Flag monoclonal antibody. Angiotensin II bound to AT1R-NF and induced endocytosis with a half-time of 2 min. After 60-90 min, fluorescence accumulated around the cell nucleus, suggesting migration of the ligand-receptor complex to the nuclear membrane. Angiotensin antagonists also induced endocytosis, suggesting that a common step in the transduction signal mechanism occurring after ligand binding may be responsible for the ligand-receptor complex internalization.
Resumo:
The precise nature of hormones and growth factors directly responsible for cartilage maturation is still largely unclear. Since longitudinal bone growth occurs through endochondral bone formation, excess or deficiency of most hormones and growth factors strongly influences final adult height. The structure and composition of the cartilaginous extracellular matrix have a critical role in regulating the behavior of growth plate chondrocytes. Therefore, the maintenance of the three-dimensional cell-matrix interaction is necessary to study the influence of individual signaling molecules on chondrogenesis, cartilage maturation and calcification. To investigate the effects of insulin on both proliferation and induction of hypertrophy in chondrocytes in vitro we used high-density micromass cultures of chick embryonic limb mesenchymal cells. Culture medium was supplemented with 1% FCS + 60 ng/ml (0.01 µM) insulin and cultures were harvested at regular time points for later analysis. Proliferating cell nuclear antigen immunoreactivity was widely detected in insulin-treated cultures and persisted until day 21 and [³H]-thymidine uptake was highest on day 14. While apoptosis increased in control cultures as a function of culture time, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-labeled cells were markedly reduced in the presence of insulin. Type II collagen production, alkaline phosphatase activity and cell size were also lower in insulin-treated cultures. Our results indicate that under the influence of 60 ng/ml insulin, chick chondrocytes maintain their proliferative potential but do not become hypertrophic, suggesting that insulin can affect the regulation of chondrocyte maturation and hypertrophy, possibly through an antiapoptotic effect.
Resumo:
We determined the effect of an H1 receptor antagonist on the functional recovery of Carassius auratus submitted to telencephalic ablation. Five days after surgery the fish underwent a spatial-choice learning paradigm test. The fish, weighing 6-12 g, were divided into four groups: telencephalic ablation (A) or sham lesion (S) and saline (SAL) or chlorpheniramine (CPA, ip, 16 mg/kg). For eight consecutive days each animal was trained individually in sessions separated by 24 h (alternate days). Training trials (T1-T8) consisted of finding the food in one of the feeders, which were randomly blocked for each subject. Animals received an intraperitoneal injection of SAL or CPA 10 min after the training trials. The time spent by the animals in each group to find the food (latency) was analyzed separately at T1 and T8 by the Kruskal-Wallis test, followed by the Student Newman-Keuls test. At T1 the latencies (mean ± SEM) of the A-SAL (586.3 ± 13.6) and A-CPA (600 ± 0) groups were significantly longer than those of the S-SAL (226.14 ± 61.15) and S-CPA (356.33 ± 68.8) groups. At T8, the latencies of the A-CPA group (510.11 ± 62.2) remained higher than those of the other groups, all of which showed significantly shorter latencies (A-SAL = 301.91 ± 78.32; S-CPA = 191.58 ± 73.03; S-SAL = 90.28 ± 41) compared with T1. These results support evidence that training can lead to functional recovery of spatial-choice learning in telencephalonless fish and also that the antagonist of the H1 receptor impairs it.
Resumo:
The present study investigated the effect of thioperamide (THIO), an H3 histaminergic receptor antagonist, microinjected into the cerebellar vermis on emotional memory consolidation in male Swiss albino mice re-exposed to the elevated plus-maze (EPM). We implanted a guide cannula into the cerebellar vermis using stereotactic surgery. On the third day after surgery, we performed behavioral tests for two consecutive days. On the first day (exposure), the mice (n=10/group) were exposed to the EPM and received THIO (0.06, 0.3, or 1.5 ng/0.1 µL) immediately after the end of the session. Twenty-four hours later, the mice were re-exposed to the EPM under the same experimental conditions, but without drug injection. A reduction in the exploration of the open arms upon re-exposure to the EPM (percentage of number of entries and time spent in open arms) compared with the initial exposure was used as an indicator of learning and memory. One-way analysis of variance (ANOVA) followed by the Duncan post hoc test was used to analyze the data. Upon re-exposure, exploratory activity in the open arms was reduced in the control group, and with the two highest THIO doses: 0.3 and 1.5 ng/0.1 µL. No reduction was seen with the lowest THIO dose (0.06 ng/0.1 µL), indicating inhibition of the consolidation of emotional memory. None of the doses interfered with the animals' locomotor activity. We conclude that THIO at the lowest dose (0.06 ng/0.1 µL) microinjected into the cerebellum impaired emotional memory consolidation in mice.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
ABSTRACT Maintaining cantaloupe melon at field temperature impairs conservation as it speeds up cell metabolism and transpiration, and, consequently, reduces shelf life. This study aimed to evaluate the conservation of Torreon hybrid cantaloupe using the hydrocooling treatment. Fruits were harvested at the commercial maturity stage (60 days after planting), in the morning, at the Nova California Farm, municipality of Mossoró-RN, in September 2007. One set of fruit was immersed in chilled water at 5 ºC for 5 min, at the packing house, while the remaining set was not hydro cooled. Then, both sets (treated and untreated with hydrocooling) were pre-cooled in air forced tunnels at 7 ºC, until the temperature in the pulp reached 10 ºC. Both fruit sets were stored for 0, 14, 21, 28 and 35 days under modified atmosphere at 3 ± 1 oC and 90 ± 5% RH. After each storage period, the fruits were incubated in an atmosphere-controlled chamber at 20 ± 2 oC and 80 ± 5% de RH, for seven days. The following characteristics were evaluated: external and internal appearance, mass loss, soluble solids, firmness and titrable acidity. The experiment was arranged in a completely randomized split-plot design with four replications of three fruits. The plots consisted of the hydrocooling conditions (with and without fruit soaking in chilled water), and the sub-plots consisted of the storage times (0, 14, 21, 28 and 35 days).The treatment with hydrocooling was efficient in keeping the firmness and soluble solids of the fruits and shortened the pre-cooling time in the cooling tunnel. However, hydrocooling did not increase fruit shelf-life.
Resumo:
Trypsin is required in the hemagglutinin (HA) cleavage to in vitro influenza viruses activation. This HA cleavage is necessary for virus cell entry by receptor-mediated endocytosis. Bacteria in the respiratory tract are potential sources of proteases that could contribute to the cleavage of influenza virus in vivo. From 47 samples collected from horses, pigs, and from humans, influenza presence was confirmed in 13 and these samples demonstrated co-infection of influenza with flagellated bacteria, Stenotrophomonas maltophilia from the beginning of the experiments. Despite treatment with antibiotics, the bacteria remained resistant in several of the co-infected samples (48.39%). These bacteria, considered opportunistic invaders from environmental sources, are associated with viral infections in upper respiratory tract of hosts. The protease (elastase), secreted by Stenotrophomonas maltophilia plays a role in the potentiation of influenza virus infection. Proteolytic activity was detected by casein agar test. Positive samples from animals and humans had either a potentiated influenza infectivity or cytopathic effect (CPE) in MDCK and NCI H292 cells, Stenotrophomonas maltophilia were always present. Virus and bacteria were observed ultrastructurally. These in vitro findings show that microbial proteases could contribute to respiratory complications by host protease activity increasing inflammation or destroying endogenous cell protease inhibitors.
Resumo:
Liver transplantation is now the standard treatment for end-stage liver disease. Given the shortage of liver donors and the progressively higher number of patients waiting for transplantation, improvements in patient selection and optimization of timing for transplantation are needed. Several solutions have been suggested, including increasing the donor pool; a fair policy for allocation, not permitting variables such as age, gender, and race, or third-party payer status to play any role; and knowledge of the natural history of each liver disease for which transplantation is offered. To observe ethical rules and distributive justice (guarantee to every citizen the same opportunity to get an organ), the "sickest first" policy must be used. Studies have demonstrated that death has no relationship with waiting time, but rather with the severity of liver disease at the time of inclusion. Thus, waiting time is no longer part of the United Network for Organ Sharing distribution criteria. Waiting time only differentiates between equally severely diseased patients. The authors have analyzed the waiting list mortality and 1-year survival for patients of the State of São Paulo, from July 1997 through January 2001. Only the chronological criterion was used. According to "Secretaria de Estado da Saúde de São Paulo" data, among all waiting list deaths, 82.2% occurred within the first year, and 37.6% within the first 3 months following inclusion. The allocation of livers based on waiting time is neither fair nor ethical, impairs distributive justice and human rights, and does not occur in any other part of the world.
Resumo:
Observational studies have attributed a protective effect to alcohol consumption on the development of atherosclerosis and cardiovascular morbidity and mortality. Alcohol intake in the amount of one to two drinks per day results in an estimated 20-40% reduction in cardiovascular events. An additional protective effect, according to major cohort studies, has been attributed to wine, probably due to antioxidant effects and platelet antiaggregation agents. On the other hand, the influence of different patterns of alcohol consumption and environmental factors may explain a great part of the additional effect of wine. Protection may be mediated by modulation of other risk factors, because alcohol increases HDL-C, produces a biphasic response on blood pressure, and modulates the endothelial function, while it neither increases body weight nor impairs glucose-insulin homeostasis. Alcohol may also have a direct effect on atherogenesis. Despite these favorable effects, the current evidence is not enough to justify prescribing alcohol to prevent cardiovascular disease.