Monounsaturated fats and immune function

Animal studies suggest that olive oil is capable of modulating functions of cells of the immune system in a manner similar to, albeit weaker than, fish oils. There is some evidence that the effects of olive oil on immune function in animal studies are due to oleic acid rather than to trace elements or antioxidants. Importantly, several studies have demonstrated effects of oleic acid-containing diets on in vivo immune responses. In contrast, consumption of a monounsaturated fatty acid (MUFA)-rich diet by humans does not appear to bring about a general suppression of immune cell functions. The effects of this diet in humans are limited to decreasing aspects of adhesion of peripheral blood mononuclear cells, although there are trends towards decreases in natural killer cell activity and proliferation. The lack of a clear effect of MUFA in humans may be attributable to the higher level of monounsaturated fat used in the animal studies, although it is ultimately of importance to examine the effects of intakes which are in no way extreme. The effects of MUFA on adhesion molecules are potentially important, since these molecules appear to have a role in the pathology of a number of diseases involving the immune system. This area clearly deserves further exploration

HIV Specific Humoral Immune Response in Rio de Janeiro, Brazil

Efforts to characterize HIV-1 polymorphism and anti-HIV immune response are being made in areas where anti-HIV/AIDS vaccines are to be employed. Anti-HIV-1 humoral immune response is being studied in infected individuals resident in Rio de Janeiro, in distinct cohorts involving recent seroconvertors, pregnant women or intravenous drug users (IDU). Comparative analyses of specificity of antibody response towards epitopes important for anti-HIV-1 immune response indicate quantitative differences between cohorts, with an exceptionally strong response in IDUs and weakest response in pregnant women. However, a comparative analysis between pregnant women cohorts from Rio de Janeiro and Rio Grande do Sul indicated an even lower response (with exception of the anti-V3-C clade peptide recognition) for the southern cohort. Studies analysing the immune function of the humoral response indicate a quite elevated occurrence of antibodies capable of neutralizing heterologous primary HIV-1 isolates from Rio de Janeiro. Attempts to correlate seroreactivity with HIV-1 neutralization with respect to HIV-1 polymorphism were not very successfull: while the Brazilian B clade B" variant could be recognized by binding assays, no significant distinction of HIV-1 clades/variants was observed in viral neutralization assays.

Effect of fatty acids on leukocyte function

Fatty acids have various effects on immune and inflammatory responses, acting as intracellular and intercellular mediators. Polyunsaturated fatty acids (PUFAs) of the omega-3 family have overall suppressive effects, inhibiting lymphocyte proliferation, antibody and cytokine production, adhesion molecule expression, natural killer cell activity and triggering cell death. The omega-6 PUFAs have both inhibitory and stimulatory effects. The most studied of these is arachidonic acid that can be oxidized to eicosanoids, such as prostaglandins, leukotrienes and thromboxanes, all of which are potent mediators of inflammation. Nevertheless, it has been found that many of the effects of PUFA on immune and inflammatory responses are not dependent on eicosanoid generation. Fatty acids have also been found to modulate phagocytosis, reactive oxygen species production, cytokine production and leukocyte migration, also interfering with antigen presentation by macrophages. The importance of fatty acids in immune function has been corroborated by many clinical trials in which patients show improvement when submitted to fatty acid supplementation. Several mechanisms have been proposed to explain fatty acid modulation of immune response, such as changes in membrane fluidity and signal transduction pathways, regulation of gene transcription, protein acylation, and calcium release. In this review, evidence is presented to support the proposition that changes in cell metabolism also play an important role in the effect of fatty acids on leukocyte functioning, as fatty acids regulate glucose and glutamine metabolism and mitochondrial depolarization.

Histiocytic necrotizing lymphadenitis (Kikuchi lymphadenitis) in an HIV-positive patient

Histiocytic necrotizing lymphadenitis, or Kikuchi's lymphadenitis (KL), is an unusual form of lymphadenitis, generally with self-limited clinical course. KL has been reported in rare patients infected with the human immunodeficiency virus (HIV). Pathogenesis of the lesion is probably related to an impaired immune function. The purpose of the present article is to report on one case in which KL was diagnosed in an HIV-infected patient. Histomorphology and immunophenotype were similar to previous reports, but a focus of activated CD30+ macrophages was seen, what might be due to the immunological status of the patient. EBV was not detected on the sections using the in situ hybridization technique. Although rare, the occurrence of KL in HIV-infected subjects must be emphasized, because of the potential misdiagnosis of malignancy, especially in the presence of CD30+ cells.

Human immunodeficiency virus/acquired immunodeficiency syndrome and tropical diseases: a Brazilian perspective

The paper summarizes recent findings on the epidemiology and pathogenesis of human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/Aids), highlighting the role of co-infections with major tropical diseases. Such co-infections have been studied in the Brazilian context since the beginning of the Aids epidemic and are expected to be more frequent and relevant as the Aids epidemic in Brazil proceeds towards smaller municipalities and the countryside, where tropical diseases are endemic. Unlike opportunistic diseases that affect basically the immunocompromised host, most tropical diseases, as well as tuberculosis, are pathogenic on their own, and can affect subjects with mild or no immunossuppression. In the era of highly active anti-retroviral therapies (HAART), opportunistic diseases seem to be on decrease in Brazil, where such medicines are fully available. Benefiting from HAART in terms of restoration of the immune function, putative milder clinical courses are expected in the future for most co-infections, including tropical diseases. On the other hand, from an ecological perspective, the progressive geographic diffusion of Aids makes tropical diseases and tuberculosis a renewed challenge for Brazilian researchers and practitioners dealing with HIV/Aids in the coming years.

Parvovirus B19 seroconversion in a cohort of human immunodeficiency virus-infected patients

Erythrovirus B19 (B19V) infection may cause red cell aplasia in patients infected with human immunodeficiency virus (HIV). The introduction of highly active antiretroviral therapy (HAART) has improved the immune function of these patients by modifying the course of B19V infection. The purpose of this study was to estimate the frequency of B19 seroconversion in a cohort of HIV-infected patients and evaluate the occurrence of B19V-related anaemia during the seroconversion period. Adult HIV-infected patients were studied at a public hospital in Niterói, state of Rio de Janeiro, Brazil. IgG and IgM antibodies against B19V were detected by an enzyme-linked immunosorbent assay and B19 viraemia was assayed by polymerase chain reaction. Medical records were reviewed for any clinical evaluation of anaemia. Seroconversion was detected in 31.8% of the 88 individuals who began the study as anti-B19V IgG-negative. No clinical manifestations of B19V infection were detected during the period of seroconversion. Patients who seroconverted were 5.40 times more likely to have anaemia than those who did not [odds ratio 5.40 (95% confidence interval: 1.33-22.93)]. Anaemia was detected in eight patients. All patients recovered from anaemia by either beginning or continuing HAART, without requiring blood transfusions. In the HAART era, B19V infection may only be associated with a course of disease characterised by less severe chronic anaemia. This milder course of B19V-associated disease is likely due to the increased immune function of HAART-treated patients.

Curbing Inflammation in hemorrhagic trauma: a review

Trauma is one of the world's leading causes of death within the first 40 years of life and thus a significant health problem. Trauma accounts for nearly a third of the lost years of productive life before 65 years of age and is associated with infection, hemorrhagic shock, reperfusion syndrome, and inflammation. The control of hemorrhage, coagulopathy, optimal use of blood products, balancing hypo and hyperperfusion, and hemostatic resuscitation improve survival in cases of trauma with massive hemorrhage. This review discusses inflammation in the context of trauma-associated hemorrhagic shock. When one considers the known immunomodulatory effects of traumatic injury, allogeneic blood transfusion, and the overlap between patient populations, it is surprising that so few studies have assessed their combined effects on immune function. We also discuss the relative benefits of curbing inflammation rather than attempting to prevent it.

Effect of prostaglandin A1 in the induction of stress proteins in Aedes albopictus cells

Prostaglandins are natural fatty acid derivatives with diverse physiological effects, including immune function and the control of cell growth. While the action of prostaglandins in the induction of stress proteins in vertebrate cells is well documented, their functions in invertebrate cells have been poorly investigated. The purpose of the present study was to investigate the effect of prostaglandin A1 (PGA1; 0.25, 1.25 and 12.5 µg/ml) on protein synthesis during the growth of Aedes albopictus cells. We found that PGA1 stimulates the synthesis of several polypeptides with molecular masses of 87, 80, 70, 57, 29, 27 and 23 kDa in Aedes albopictus cells. When the proteins induced by PGA1 and those induced by heat treatment were compared by polyacrylamide gel electrophoresis, PGA1 was found to induce the stress proteins. The HSP70 family and the low-molecular weight polypeptides (29 and 27 kDa, respectively) were induced by PGA1 in the lag phase. We also observed that PGA1 is able to induce a 23-kDa polypeptide independently of the growth phase of the cell

Changes in the TBARs content and superoxide dismutase, catalase and glutathione peroxidase activities in the lymphoid organs and skeletal muscles of adrenodemedullated rats

Thiobarbituric acid reactant substances (TBARs) content, and the activities of glucose-6-phosphate dehydrogenase (G6PDh), citrate synthase (CS), Cu/Zn- and Mn-superoxide dismutase (SOD), catalase, and glutathione peroxidase (GPX) were measured in the lymphoid organs (thymus, spleen, and mesenteric lymph nodes (MLN)) and skeletal muscles (gastrocnemius and soleus) of adrenodemedullated (ADM) rats. The results were compared with those obtained for sham-operated rats. TBARs content was reduced by adrenodemedullation in the lymphoid organs (MLN (28%), thymus (40%) and spleen (42%)) and gastrocnemius muscle (67%). G6PDh activity was enhanced in the MLN (69%) and reduced in the spleen (28%) and soleus muscle (75%). CS activity was reduced in all tissues (MLN (75%), spleen (71%), gastrocnemius (61%) and soleus (43%)), except in the thymus which displayed an increment of 56%. Cu/Zn-SOD activity was increased in the MLN (126%), thymus (223%), spleen (80%) and gastrocnemius muscle (360%) and was reduced in the soleus muscle (31%). Mn-SOD activity was decreased in the MLN (67%) and spleen (26%) and increased in the thymus (142%), whereas catalase activity was reduced in the MLN (76%), thymus (54%) and soleus muscle (47%). It is particularly noteworthy that in ADM rats the activity of glutathione peroxidase was not detectable by the method used. These data are consistent with the possibility that epinephrine might play a role in the oxidative stress of the lymphoid organs. Whether this fact represents an important mechanism for the establishment of impaired immune function during stress remains to be elucidated.

Regulation of antioxidant enzyme activities in male and female rat macrophages by sex steroids

Human and animal immune functions present sex dimorphism that seems to be mainly regulated by sex hormones. In the present study, the activities of the antioxidant enzymes total superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) were measured in intraperitoneal resident macrophages from adult male and female rats. In addition to comparing males and females, we also examined the regulation of these enzyme activities in macrophages by sex steroids. GSH-Px activity did not differ between male and female macrophages. However, both total SOD and CAT activities were markedly higher in females than in males (83 and 180%). Removal of the gonads in both males and females (comparison between castrated groups) increased the difference in SOD activity from 83 to 138% and reduced the difference in CAT activity from 180 to 86%. Castration and testosterone administration did not significantly modify the activities of the antioxidant enzymes in male macrophages. Ovariectomy did not affect SOD or GSH-Px activity but markedly reduced (48%) CAT activity. This latter change was fully reversed by estrogen administration, whereas progesterone had a smaller effect. These results led us to conclude that differences in the SOD and CAT activities may partially explain some of the differences in immune function reported for males and females. Also, estrogen is a potent regulator of CAT in macrophages and therefore this enzyme activity in macrophages may vary considerably during the menstrual cycle.

Long-chain n-3 fatty acids and inflammation: potential application in surgical and trauma patients

Lipids used in nutritional support of surgical or critically ill patients have been based on soybean oil, which is rich in the n-6 fatty acid linoleic acid (18:2n-6). Linoleic acid is the precursor of arachidonic acid (20:4n-6). In turn, arachidonic acid in cell membrane phospholipids is the substrate for the synthesis of a range of biologically active compounds (eicosanoids) including prostaglandins, thromboxanes, and leukotrienes. These compounds can act as mediators in their own right and can also act as regulators of other processes, such as platelet aggregation, blood clotting, smooth muscle contraction, leukocyte chemotaxis, inflammatory cytokine production, and immune function. There is a view that an excess of n-6 fatty acids should be avoided since this could contribute to a state where physiological processes become dysregulated. One alternative is the use of fish oil. The rationale of this latter approach is that fish oil contains long chain n-3 fatty acids, such as eicosapentaenoic acid. When fish oil is provided, eicosapentaenoic acid is incorporated into cell membrane phospholipids, partly at the expense of arachidonic acid. Thus, there is less arachidonic acid available for eicosanoid synthesis. Hence, fish oil decreases production of prostaglandins like PGE2 and of leukotrienes like LTB4. Thus, n-3 fatty acids can potentially reduce platelet aggregation, blood clotting, smooth muscle contraction, and leukocyte chemotaxis, and can modulate inflammatory cytokine production and immune function. These effects have been demonstrated in cell culture, animal feeding and healthy volunteer studies. Fish oil decreases the host metabolic response and improves survival to endotoxin in laboratory animals. Recently clinical studies performed in various patient groups have indicated benefit from this approach.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Immunopathology of human schistosomiasis mansoni: I. Immunomodulatory influences on T cell function

Cell mediated immune response was studied in patients with recent and chronic Schistosoma mansoni infection. Precultured peripheral mononuclear cells showed significantly higher responses to S. mansoni adult worm antigen (SAWA) when compared to fresh cell preparations. The addition of each patient serum to the precultured cells reactions to SAWA or recall antigens demonstrated a strong inhibitory serum action, which was also noted on allogeneic cells derived from healthy subjects. The CD4 subset was the main responding cell to SAWA being this reactivity highly suppressed by the presence of the monocyte macrophage accessory cells. We stressed the simultaneous inhibitory action of humoral and cellular factors on the specific cell response to S. mansoni.

Leptospirosis severity may be associated with the intensity of humoral immune response

Leptospirosis severity may be increasing, with pulmonary involvement becoming more frequent. Does this increase result from an intense immune response to leptospire? Notice that renal failure, thrombocytopenia and pulmonary complications are found during the immune phase. Thirty-five hospitalized patients with Weil's disease had 5 blood samples drawn, from the 15th day to the 12th month of symptoms, for ELISA-IgM, -IgG and -IgA specific antibody detection. According their 1st IgG titer, the patients were divided into: group 1 (n = 13) titer > 1:400 (positive) and group 2 (n = 22) titer <=1:400 (negative). Early IgG antibodies in group 1 showed high avidity which may indicate reinfection. Group 1 was older, had worse pulmonary and renal function, and fever for a longer period than group 2. Throughout the study, IgG and IgA titers remained higher in group 1. In conclusion, the severity of Weil's disease may be associated with the intensity of the humoral immune response to leptospire.

Differing phagocytic function of monocytes and neutrophils in Chagas' cardiopathy according to the presence or absence of congestive heart failure

We evaluated the in vitro phagocytic function and the production of microbicidal oxygen radicals by monocytes and neutrophils of 9 Chagas' heart disease subjects with heart failure and 9 without the syndrome in comparison with 11 healthy subjects, by assessing phagocytosis of Saccharomyces cerevisiae and NBT reduction by peripheral blood phagocytes. Phagocytic index of monocytes of chagasics without heart failure was significantly 6.7 and 10.6 times lower than those of controls and chagasics with the congestive syndrome, respectively, due to a lesser engagement in phagocytosis and to an inability of these cells to ingest particles. Neutrophils also show in chagasics without heart failure PI 11.2 and 19.8 times lower than that of controls and chagasics with heart failure, respectively. The percent of NBT reduction was normal and similar for the three groups. Balanced opposite effects of cardiovascular and immune disturbances may be acting in Chagas' disease subjects with heart failure paradoxically recovering the altered phagocytic function.